Miyakogusa Predicted Gene
- Lj4g3v2742890.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2742890.1 tr|G7LE13|G7LE13_MEDTR Phosphatidylinositol
4-kinase OS=Medicago truncatula GN=MTR_8g093570 PE=4
SV=,78.67,2e-18,seg,NULL; PHOSPHATIDYLINOSITOL 4-KINASE
BETA,Phosphatidylinositol 4-kinase; PHOSPHATIDYLINOSITOL
KIN,NODE_10174_length_1004_cov_143.650406.path2.1
(195 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP065209 similar to UniRef100_Q8LPD1 Cluster: Phophatdy... 52 1e-06
>gnl|LJGI|BP065209 similar to UniRef100_Q8LPD1 Cluster: Phophatdylinositol 4-kinase;
n=1; Oryza sativa|Rep: Phophatdylinositol 4-kinase -
Oryza sativa (Rice), partial (5%)
Length = 379
Score = 52.0 bits (26), Expect = 1e-06
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 154 cagtatgactattatcagaaggttttgaatggaatatt 191
|||||||| ||||| |||||| ||||||||||||||||
Sbjct: 378 cagtatgattattaccagaagtttttgaatggaatatt 341