Miyakogusa Predicted Gene

Lj4g3v2717170.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2717170.1 tr|E2FKH5|E2FKH5_SOYBN Sieve element occlusion e
OS=Glycine max GN=SEOe PE=2 SV=1,76.81,0,seg,NULL; SUBFAMILY NOT
NAMED,NULL; THIOREDOXIN,NULL,CUFF.51552.1
         (2109 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78158                                                       70   6e-11

>gnl|LJGI|TC78158 
          Length = 464

 Score = 69.9 bits (35), Expect = 6e-11
 Identities = 129/159 (81%), Gaps = 1/159 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1869 acagggcaagggagacacatttataaaatgccttgaggaacatgagcactggaaggataa 1928
            |||||||||  ||| ||||||||| |  |||||||| |||||||| || |||||| ||||
Sbjct: 119  acagggcaatcgaggcacatttattatgtgccttgatgaacatgaccagtggaagaataa 178

                                                                        
Query: 1929 ggttaatgataaagggtttttgccagcaatggatgatt-atatgcaagaactccaaaccc 1987
            || ||  ||||||||| |||||| |  ||||| ||||| ||| ||||||||||||||| |
Sbjct: 179  ggctagagataaagggattttgcaaagaatggctgatttataagcaagaactccaaacgc 238

                                                   
Query: 1988 cacatcactgcaatcgtttgattctgccaggagtcaatg 2026
            || | || || |||||  |||| ||| ||||||| ||||
Sbjct: 239  cataccattgtaatcgcctgatactgtcaggagttaatg 277