Miyakogusa Predicted Gene
- Lj4g3v2704630.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2704630.1 Non Chatacterized Hit- tr|K3ZQX3|K3ZQX3_SETIT
Uncharacterized protein OS=Setaria italica
GN=Si029003,44.33,9e-16,PIPK,Phosphatidylinositol-4-phosphate
5-kinase, core; PHOSPHATIDYLINOSITOL-4-PHOSPHATE
5-KINASE,NULL,CUFF.51511.1
(1275 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC72651 similar to UniRef100_A7QJD6 Cluster: Chromosome... 76 6e-13
>gnl|LJGI|TC72651 similar to UniRef100_A7QJD6 Cluster: Chromosome chr8 scaffold_106,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_106, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (56%)
Length = 1529
Score = 75.8 bits (38), Expect = 6e-13
Identities = 74/86 (86%)
Strand = Plus / Plus
Query: 955 tggaaagattattgccctatggtcttcaggaatttgagagagatgttcaaattagatgct 1014
|||||||||||||| || ||||| ||||| |||||||||||| ||||||| | ||||||
Sbjct: 846 tggaaagattattgtccaatggtgttcagaaatttgagagagttgttcaagattgatgct 905
Query: 1015 gcagagtacatgatgtctatttgtgg 1040
|| || || |||||||| ||||||||
Sbjct: 906 gctgactatatgatgtccatttgtgg 931