Miyakogusa Predicted Gene
- Lj4g3v2690750.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2690750.1 Non Chatacterized Hit- tr|I3S4Y2|I3S4Y2_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,97.89,0,2Fe-2S
ferredoxin-like,2Fe-2S ferredoxin-type domain; seg,NULL; no
description,Beta-grasp domain; fd,CUFF.51462.1
(429 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC61318 similar to UniRef100_Q5G1L9 Cluster: Chloroplas... 811 0.0
gnl|LJGI|TC60314 similar to UniRef100_Q6Y2F4 Cluster: Ferredoxin... 234 4e-61
gnl|LJGI|TC82564 similar to UniRef100_Q1RU96 Cluster: Hemopexin;... 107 6e-23
>gnl|LJGI|TC61318 similar to UniRef100_Q5G1L9 Cluster: Chloroplast ferredoxin I; n=1;
Nicotiana tabacum|Rep: Chloroplast ferredoxin I -
Nicotiana tabacum (Common tobacco), partial (83%)
Length = 734
Score = 811 bits (409), Expect = 0.0
Identities = 424/429 (98%)
Strand = Plus / Plus
Query: 1 atggccaccacaccagctctctcaggaaccatggtgaacacctccttcctgaggaggcag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 83 atggccaccacaccagctctctcaggaaccatggtgaacacctccttcctgaggaggcag 142
Query: 61 ccattgaaggcattcccaaacgtgggtcaggctctgtttggcctgaaatctggctgtggc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 ccattgaaggcattcccaaacgtgggtcaggctctgtttggcctgaaatctggctgtggc 202
Query: 121 ggccgtgttaccatggctgctttcaaggtggagcttatcaccccagagggacctttcgag 180
|||||||| ||||||||||||| ||||||| |||| ||||||||||||||||||||||||
Sbjct: 203 ggccgtgtcaccatggctgcttacaaggtgaagctcatcaccccagagggacctttcgag 262
Query: 181 ttcgagtgcccggctgatgtttacattcttgaccatgcagaggagcaaggcattgacatt 240
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 263 ttcgagtgcccggatgatgtttacattcttgaccatgcagaggagcaaggcattgacatt 322
Query: 241 ccctactcatgcagggctggctcttgctcttcctgtgctgggaaagttgtaggagggaat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 323 ccctactcatgcagggctggctcttgctcttcctgtgctgggaaagttgtaggagggaat 382
Query: 301 gtggaccagtcagatggtagcttccttgatgatgatcagatagatgctgggtttgttctc 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 383 gtggaccagtcagatggtagcttccttgatgatgatcagatagatgctgggtttgttctc 442
Query: 361 acttgtgttgcttaccctcagtcagatgttgttattgagacccacaaggaggaagagctc 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 443 acttgtgttgcttaccctcagtcagatgttgttattgagacccacaaggaggaagagctc 502
Query: 421 actgcttaa 429
|||||||||
Sbjct: 503 actgcttaa 511
>gnl|LJGI|TC60314 similar to UniRef100_Q6Y2F4 Cluster: Ferredoxin; n=1; Helianthus
annuus|Rep: Ferredoxin - Helianthus annuus (Common
sunflower), partial (86%)
Length = 846
Score = 234 bits (118), Expect = 4e-61
Identities = 259/306 (84%)
Strand = Plus / Plus
Query: 124 cgtgttaccatggctgctttcaaggtggagcttatcaccccagagggacctttcgagttc 183
||||| ||||||||||||| ||||||| |||| ||||||||||||||||| |||||
Sbjct: 285 cgtgtaaccatggctgcttacaaggtgaagctcatcaccccagagggaccgcaagagttt 344
Query: 184 gagtgcccggctgatgtttacattcttgaccatgcagaggagcaaggcattgacattccc 243
||||| || | ||||||||||||||| ||||| || ||||| ||||||||| |||||
Sbjct: 345 gagtgtccagatgatgtttacattctggaccaggcggaggaagtaggcattgatattcct 404
Query: 244 tactcatgcagggctggctcttgctcttcctgtgctgggaaagttgtaggagggaatgtg 303
||||||||||||||||| ||||||||||||||||| || || ||||||| ||| |||
Sbjct: 405 tactcatgcagggctggttcttgctcttcctgtgccggcaaggttgtagaaggtgcagtg 464
Query: 304 gaccagtcagatggtagcttccttgatgatgatcagatagatgctgggtttgttctcact 363
|||||||| |||||| |||||||||||||| || | || | || ||||||||||||
Sbjct: 465 gaccagtctgatggttcgttccttgatgatgaccaagttgaaggaggctttgttctcact 524
Query: 364 tgtgttgcttaccctcagtcagatgttgttattgagacccacaaggaggaagagctcact 423
|| ||||||||||| |||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 525 tgcgttgcttaccccaagtctgatgttgttattgagactcacaaggaggaagagctcact 584
Query: 424 gcttaa 429
| ||||
Sbjct: 585 ggttaa 590
>gnl|LJGI|TC82564 similar to UniRef100_Q1RU96 Cluster: Hemopexin; n=1; Medicago
truncatula|Rep: Hemopexin - Medicago truncatula (Barrel
medic), partial (7%)
Length = 653
Score = 107 bits (54), Expect = 6e-23
Identities = 72/78 (92%)
Strand = Plus / Minus
Query: 352 tttgttctcacttgtgttgcttaccctcagtcagatgttgttattgagacccacaaggag 411
|||||||||||||| ||||||||||| |||| ||||||||||||||||| |||||||||
Sbjct: 225 tttgttctcacttgcgttgcttaccccaagtctgatgttgttattgagactcacaaggag 166
Query: 412 gaagagctcactgcttaa 429
||||||||||||| ||||
Sbjct: 165 gaagagctcactggttaa 148