Miyakogusa Predicted Gene

Lj4g3v2678620.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2678620.1 tr|B9GY61|B9GY61_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_647445 PE=4
SV=1,94.59,0.00000000006,CALPAIN_CAT,Peptidase C2, calpain, catalytic
domain; CALPAIN,Peptidase C2, calpain family; Calpain_I,CUFF.51454.1
         (819 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW594717 homologue to UniRef100_Q6SSJ2 Cluster: Phytoca...    94   2e-18

>gnl|LJGI|BW594717 homologue to UniRef100_Q6SSJ2 Cluster: Phytocalpain; n=1; Nicotiana
           benthamiana|Rep: Phytocalpain - Nicotiana benthamiana,
           partial (7%)
          Length = 483

 Score = 93.7 bits (47), Expect = 2e-18
 Identities = 47/47 (100%)
 Strand = Plus / Plus

                                                          
Query: 1   atgagaagtggtgaagcccagattgaccttgcaagtggtagattgtg 47
           |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 437 atgagaagtggtgaagcccagattgaccttgcaagtggtagattgtg 483