Miyakogusa Predicted Gene

Lj4g3v2618520.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2618520.1 Non Chatacterized Hit- tr|K4BEQ5|K4BEQ5_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,29.2,0.002,MIP,Major intrinsic protein; no
description,Aquaporin-like; NODULIN-26-RELATED,NULL; AQUAPORIN
TRANS,CUFF.51347.1
         (399 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO041105 similar to UniRef100_Q9XGG7 Cluster: Nodulin26...   123   9e-28
gnl|LJGI|TC57367 UniRef100_Q9LKJ5 Cluster: Multifunctional trans...   119   1e-26
gnl|LJGI|GO033955 similar to UniRef100_Q9LKJ5 Cluster: Multifunc...   115   2e-25
gnl|LJGI|TC82453 similar to UniRef100_Q9XGG7 Cluster: Nodulin26-...   111   3e-24
gnl|LJGI|TC57271 similar to UniRef100_Q8W4T7 Cluster: Multifunct...    94   8e-19
gnl|LJGI|GO039834 similar to UniRef100_Q6QIL2 Cluster: NIP2; n=1...    74   7e-13

>gnl|LJGI|GO041105 similar to UniRef100_Q9XGG7 Cluster: Nodulin26-like major intrinsic
           protein; n=1; Pisum sativum|Rep: Nodulin26-like major
           intrinsic protein - Pisum sativum (Garden pea), partial
           (73%)
          Length = 788

 Score =  123 bits (62), Expect = 9e-28
 Identities = 179/218 (82%)
 Strand = Plus / Minus

                                                                       
Query: 56  acctgcaagcttttgtgattgaattcataaccacttttctcctaatgtttgtcatatcag 115
           |||| ||||||||| | ||||| ||||||| |||||| |  || |||||||| || || |
Sbjct: 475 accttcaagcttttcttattgagttcataatcactttccaactcatgtttgttatttctg 416

                                                                       
Query: 116 cagttgccactgataacagagcgattggtgagatggctgggattgcaattgggtctacat 175
           |||| ||||| ||||||||||||||||||||| ||||||| |||||| ||||||| ||  
Sbjct: 415 cagtagccacagataacagagcgattggtgagttggctggaattgcagttgggtcaacga 356

                                                                       
Query: 176 tactgctaaatatattgatttcagggccgatcacaggagcctcaatgaacccagcaagaa 235
           || || ||||| | ||| || | ||||| ||||| ||||| ||| |||| ||||||||||
Sbjct: 355 taatgataaatgtgttgtttgccgggccaatcaccggagcatcattgaatccagcaagaa 296

                                                 
Query: 236 ccctaggacctgctatttttcacagtaaatacagagca 273
            |||||||||||| ||| | |||| ||| |||| ||||
Sbjct: 295 gcctaggacctgcaattgtacacaataattacacagca 258


>gnl|LJGI|TC57367 UniRef100_Q9LKJ5 Cluster: Multifunctional transport intrinsic
           membrane protein 2; n=1; Lotus japonicus|Rep:
           Multifunctional transport intrinsic membrane protein 2 -
           Lotus japonicus, complete
          Length = 1193

 Score =  119 bits (60), Expect = 1e-26
 Identities = 288/364 (79%)
 Strand = Plus / Plus

                                                                       
Query: 5   tatttagtggcacgcatgaccagttttcaggaacaatcccatctgggactaacctgcaag 64
           |||| ||||||| |||| |||| ||| ||||| || ||||| ||||| |||| |||||||
Sbjct: 507 tattcagtggcaagcataaccaatttgcaggagcactcccaactgggtctaatctgcaag 566

                                                                       
Query: 65  cttttgtgattgaattcataaccacttttctcctaatgtttgtcatatcagcagttgcca 124
           ||||||||||||||||||||| ||||||| |||| || ||| || |||  |  |||||||
Sbjct: 567 cttttgtgattgaattcataatcacttttttccttatctttatcttatttggggttgcca 626

                                                                       
Query: 125 ctgataacagagcgattggtgagatggctgggattgcaattgggtctacattactgctaa 184
           ||||| |  |||||||||||||| | ||||||||||   | || |||||| | ||  | |
Sbjct: 627 ctgatgatcgagcgattggtgaggttgctgggattgtggtgggatctacagtgcttttga 686

                                                                       
Query: 185 atatattgatttcagggccgatcacaggagcctcaatgaacccagcaagaaccctaggac 244
           || | ||| || ||||||| || || ||||| ||||||||||||||||||| | ||||  
Sbjct: 687 atgtgttgtttgcagggccaataactggagcatcaatgaacccagcaagaagcatagggt 746

                                                                       
Query: 245 ctgctatttttcacagtaaatacagagcaatagtggtatactttgtgtcaactatttttg 304
           ||||| || | |||| | | ||||||| ||||  | |||||||  | ||  | | | | |
Sbjct: 747 ctgcttttgtacacaatgagtacagaggaatatggatatacttgctatctccaactctgg 806

                                                                       
Query: 305 gggctgtggctggagcatgggtcttcaacatcctcagatacacagacaagccattacatg 364
           |||| |||||||| ||||||||||  |||||| |  | ||||||||||||||||| | ||
Sbjct: 807 gggcagtggctggtgcatgggtctataacatcgttcgctacacagacaagccattgcgtg 866

               
Query: 365 agat 368
           ||||
Sbjct: 867 agat 870


>gnl|LJGI|GO033955 similar to UniRef100_Q9LKJ5 Cluster: Multifunctional transport
           intrinsic membrane protein 2; n=1; Lotus japonicus|Rep:
           Multifunctional transport intrinsic membrane protein 2 -
           Lotus japonicus, partial (67%)
          Length = 640

 Score =  115 bits (58), Expect = 2e-25
 Identities = 127/150 (84%)
 Strand = Plus / Plus

                                                                       
Query: 12  tggcacgcatgaccagttttcaggaacaatcccatctgggactaacctgcaagcttttgt 71
           ||||| |||| | |||||| |||||||| ||||| ||||| ||||| | |||||||||||
Sbjct: 490 tggcaagcataatcagtttacaggaacactcccagctgggtctaacttacaagcttttgt 549

                                                                       
Query: 72  gattgaattcataaccacttttctcctaatgtttgtcatatcagcagttgccactgataa 131
           |||||||||||||| |||||||  ||| |||||  ||||||| |  || |||||||||||
Sbjct: 550 gattgaattcataatcactttttaccttatgttcatcatatctggggtggccactgataa 609

                                         
Query: 132 cagagcgattggtgagatggctgggattgc 161
             |||| ||||||||| |||||||||||||
Sbjct: 610 tcgagcaattggtgagttggctgggattgc 639


>gnl|LJGI|TC82453 similar to UniRef100_Q9XGG7 Cluster: Nodulin26-like major intrinsic
           protein; n=1; Pisum sativum|Rep: Nodulin26-like major
           intrinsic protein - Pisum sativum (Garden pea), partial
           (86%)
          Length = 1238

 Score =  111 bits (56), Expect = 3e-24
 Identities = 161/196 (82%)
 Strand = Plus / Plus

                                                                       
Query: 56  acctgcaagcttttgtgattgaattcataaccacttttctcctaatgtttgtcatatcag 115
           |||| |||||||||||| |||||||||||||||||||    || |||||||| || || |
Sbjct: 762 accttcaagcttttgtggttgaattcataaccactttctatctcatgtttgtaatttctg 821

                                                                       
Query: 116 cagttgccactgataacagagcgattggtgagatggctgggattgcaattgggtctacat 175
            ||||||||| || |||||||| ||||||||  |||| ||| ||||||||||| ||||  
Sbjct: 822 gagttgccacggacaacagagctattggtgaattggcagggcttgcaattgggcctacca 881

                                                                       
Query: 176 tactgctaaatatattgatttcagggccgatcacaggagcctcaatgaacccagcaagaa 235
           | ||||||||| |  ||||| | ||||| ||||| ||||| |||||||| || |||||||
Sbjct: 882 tcctgctaaatgtcatgattgccgggccaatcactggagcatcaatgaatcctgcaagaa 941

                           
Query: 236 ccctaggacctgctat 251
              |||||||||||||
Sbjct: 942 gtttaggacctgctat 957


>gnl|LJGI|TC57271 similar to UniRef100_Q8W4T7 Cluster: Multifunctional aquaporin;
           n=1; Medicago truncatula|Rep: Multifunctional aquaporin
           - Medicago truncatula (Barrel medic), partial (79%)
          Length = 1225

 Score = 93.7 bits (47), Expect = 8e-19
 Identities = 158/195 (81%)
 Strand = Plus / Plus

                                                                       
Query: 58  ctgcaagcttttgtgattgaattcataaccacttttctcctaatgtttgtcatatcagca 117
           ||||||||||||||| ||||||||||  ||||||| |  || |||||||  || || | |
Sbjct: 556 ctgcaagcttttgtgtttgaattcatttccactttccatctcatgtttgcaatttcggga 615

                                                                       
Query: 118 gttgccactgataacagagcgattggtgagatggctgggattgcaattgggtctacatta 177
           ||  |||| || |||||||| |||||||| ||||||||  ||||||||||| ||||  ||
Sbjct: 616 gtatccacagacaacagagctattggtgaaatggctggacttgcaattggggctacgata 675

                                                                       
Query: 178 ctgctaaatatattgatttcagggccgatcacaggagcctcaatgaacccagcaagaacc 237
           ||||||||| |  | ||| | || || ||||| ||||| || ||||| |||||||||| |
Sbjct: 676 ctgctaaatgtgataattgccggaccaatcactggagcatcgatgaatccagcaagaagc 735

                          
Query: 238 ctaggacctgctatt 252
            ||||||||||||||
Sbjct: 736 ttaggacctgctatt 750


>gnl|LJGI|GO039834 similar to UniRef100_Q6QIL2 Cluster: NIP2; n=1; Medicago
           truncatula|Rep: NIP2 - Medicago truncatula (Barrel
           medic), partial (30%)
          Length = 317

 Score = 73.8 bits (37), Expect = 7e-13
 Identities = 157/197 (79%)
 Strand = Plus / Minus

                                                                       
Query: 197 cagggccgatcacaggagcctcaatgaacccagcaagaaccctaggacctgctatttttc 256
           ||||||| || || ||||| ||||||||||||||||||| | |||| ||||| ||| | |
Sbjct: 274 cagggccaataactggagcatcaatgaacccagcaagaagcataggccctgccattgtgc 215

                                                                       
Query: 257 acagtaaatacagagcaatagtggtatactttgtgtcaactatttttggggctgtggctg 316
           |  || ||||||||| ||||  | ||||||| |||||  | ||| | ||||| |||||||
Sbjct: 214 atggtgaatacagaggaatatggatatacttggtgtctccaattatgggggcagtggctg 155

                                                                       
Query: 317 gagcatgggtcttcaacatcctcagatacacagacaagccattacatgagataaccaagg 376
           | |||||||||| ||| ||| |  | || || ||||||||||| | |||||| || ||||
Sbjct: 154 gtgcatgggtctacaatatcgttcgctatacggacaagccattgcgtgagatcacaaagg 95

                            
Query: 377 gttcctctatcctcaaa 393
           || ||||| | ||||||
Sbjct: 94  gtgcctcttttctcaaa 78