Miyakogusa Predicted Gene
- Lj4g3v2618520.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2618520.1 Non Chatacterized Hit- tr|K4BEQ5|K4BEQ5_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,29.2,0.002,MIP,Major intrinsic protein; no
description,Aquaporin-like; NODULIN-26-RELATED,NULL; AQUAPORIN
TRANS,CUFF.51347.1
(399 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO041105 similar to UniRef100_Q9XGG7 Cluster: Nodulin26... 123 9e-28
gnl|LJGI|TC57367 UniRef100_Q9LKJ5 Cluster: Multifunctional trans... 119 1e-26
gnl|LJGI|GO033955 similar to UniRef100_Q9LKJ5 Cluster: Multifunc... 115 2e-25
gnl|LJGI|TC82453 similar to UniRef100_Q9XGG7 Cluster: Nodulin26-... 111 3e-24
gnl|LJGI|TC57271 similar to UniRef100_Q8W4T7 Cluster: Multifunct... 94 8e-19
gnl|LJGI|GO039834 similar to UniRef100_Q6QIL2 Cluster: NIP2; n=1... 74 7e-13
>gnl|LJGI|GO041105 similar to UniRef100_Q9XGG7 Cluster: Nodulin26-like major intrinsic
protein; n=1; Pisum sativum|Rep: Nodulin26-like major
intrinsic protein - Pisum sativum (Garden pea), partial
(73%)
Length = 788
Score = 123 bits (62), Expect = 9e-28
Identities = 179/218 (82%)
Strand = Plus / Minus
Query: 56 acctgcaagcttttgtgattgaattcataaccacttttctcctaatgtttgtcatatcag 115
|||| ||||||||| | ||||| ||||||| |||||| | || |||||||| || || |
Sbjct: 475 accttcaagcttttcttattgagttcataatcactttccaactcatgtttgttatttctg 416
Query: 116 cagttgccactgataacagagcgattggtgagatggctgggattgcaattgggtctacat 175
|||| ||||| ||||||||||||||||||||| ||||||| |||||| ||||||| ||
Sbjct: 415 cagtagccacagataacagagcgattggtgagttggctggaattgcagttgggtcaacga 356
Query: 176 tactgctaaatatattgatttcagggccgatcacaggagcctcaatgaacccagcaagaa 235
|| || ||||| | ||| || | ||||| ||||| ||||| ||| |||| ||||||||||
Sbjct: 355 taatgataaatgtgttgtttgccgggccaatcaccggagcatcattgaatccagcaagaa 296
Query: 236 ccctaggacctgctatttttcacagtaaatacagagca 273
|||||||||||| ||| | |||| ||| |||| ||||
Sbjct: 295 gcctaggacctgcaattgtacacaataattacacagca 258
>gnl|LJGI|TC57367 UniRef100_Q9LKJ5 Cluster: Multifunctional transport intrinsic
membrane protein 2; n=1; Lotus japonicus|Rep:
Multifunctional transport intrinsic membrane protein 2 -
Lotus japonicus, complete
Length = 1193
Score = 119 bits (60), Expect = 1e-26
Identities = 288/364 (79%)
Strand = Plus / Plus
Query: 5 tatttagtggcacgcatgaccagttttcaggaacaatcccatctgggactaacctgcaag 64
|||| ||||||| |||| |||| ||| ||||| || ||||| ||||| |||| |||||||
Sbjct: 507 tattcagtggcaagcataaccaatttgcaggagcactcccaactgggtctaatctgcaag 566
Query: 65 cttttgtgattgaattcataaccacttttctcctaatgtttgtcatatcagcagttgcca 124
||||||||||||||||||||| ||||||| |||| || ||| || ||| | |||||||
Sbjct: 567 cttttgtgattgaattcataatcacttttttccttatctttatcttatttggggttgcca 626
Query: 125 ctgataacagagcgattggtgagatggctgggattgcaattgggtctacattactgctaa 184
||||| | |||||||||||||| | |||||||||| | || |||||| | || | |
Sbjct: 627 ctgatgatcgagcgattggtgaggttgctgggattgtggtgggatctacagtgcttttga 686
Query: 185 atatattgatttcagggccgatcacaggagcctcaatgaacccagcaagaaccctaggac 244
|| | ||| || ||||||| || || ||||| ||||||||||||||||||| | ||||
Sbjct: 687 atgtgttgtttgcagggccaataactggagcatcaatgaacccagcaagaagcatagggt 746
Query: 245 ctgctatttttcacagtaaatacagagcaatagtggtatactttgtgtcaactatttttg 304
||||| || | |||| | | ||||||| |||| | ||||||| | || | | | | |
Sbjct: 747 ctgcttttgtacacaatgagtacagaggaatatggatatacttgctatctccaactctgg 806
Query: 305 gggctgtggctggagcatgggtcttcaacatcctcagatacacagacaagccattacatg 364
|||| |||||||| |||||||||| |||||| | | ||||||||||||||||| | ||
Sbjct: 807 gggcagtggctggtgcatgggtctataacatcgttcgctacacagacaagccattgcgtg 866
Query: 365 agat 368
||||
Sbjct: 867 agat 870
>gnl|LJGI|GO033955 similar to UniRef100_Q9LKJ5 Cluster: Multifunctional transport
intrinsic membrane protein 2; n=1; Lotus japonicus|Rep:
Multifunctional transport intrinsic membrane protein 2 -
Lotus japonicus, partial (67%)
Length = 640
Score = 115 bits (58), Expect = 2e-25
Identities = 127/150 (84%)
Strand = Plus / Plus
Query: 12 tggcacgcatgaccagttttcaggaacaatcccatctgggactaacctgcaagcttttgt 71
||||| |||| | |||||| |||||||| ||||| ||||| ||||| | |||||||||||
Sbjct: 490 tggcaagcataatcagtttacaggaacactcccagctgggtctaacttacaagcttttgt 549
Query: 72 gattgaattcataaccacttttctcctaatgtttgtcatatcagcagttgccactgataa 131
|||||||||||||| ||||||| ||| ||||| ||||||| | || |||||||||||
Sbjct: 550 gattgaattcataatcactttttaccttatgttcatcatatctggggtggccactgataa 609
Query: 132 cagagcgattggtgagatggctgggattgc 161
|||| ||||||||| |||||||||||||
Sbjct: 610 tcgagcaattggtgagttggctgggattgc 639
>gnl|LJGI|TC82453 similar to UniRef100_Q9XGG7 Cluster: Nodulin26-like major intrinsic
protein; n=1; Pisum sativum|Rep: Nodulin26-like major
intrinsic protein - Pisum sativum (Garden pea), partial
(86%)
Length = 1238
Score = 111 bits (56), Expect = 3e-24
Identities = 161/196 (82%)
Strand = Plus / Plus
Query: 56 acctgcaagcttttgtgattgaattcataaccacttttctcctaatgtttgtcatatcag 115
|||| |||||||||||| ||||||||||||||||||| || |||||||| || || |
Sbjct: 762 accttcaagcttttgtggttgaattcataaccactttctatctcatgtttgtaatttctg 821
Query: 116 cagttgccactgataacagagcgattggtgagatggctgggattgcaattgggtctacat 175
||||||||| || |||||||| |||||||| |||| ||| ||||||||||| ||||
Sbjct: 822 gagttgccacggacaacagagctattggtgaattggcagggcttgcaattgggcctacca 881
Query: 176 tactgctaaatatattgatttcagggccgatcacaggagcctcaatgaacccagcaagaa 235
| ||||||||| | ||||| | ||||| ||||| ||||| |||||||| || |||||||
Sbjct: 882 tcctgctaaatgtcatgattgccgggccaatcactggagcatcaatgaatcctgcaagaa 941
Query: 236 ccctaggacctgctat 251
|||||||||||||
Sbjct: 942 gtttaggacctgctat 957
>gnl|LJGI|TC57271 similar to UniRef100_Q8W4T7 Cluster: Multifunctional aquaporin;
n=1; Medicago truncatula|Rep: Multifunctional aquaporin
- Medicago truncatula (Barrel medic), partial (79%)
Length = 1225
Score = 93.7 bits (47), Expect = 8e-19
Identities = 158/195 (81%)
Strand = Plus / Plus
Query: 58 ctgcaagcttttgtgattgaattcataaccacttttctcctaatgtttgtcatatcagca 117
||||||||||||||| |||||||||| ||||||| | || ||||||| || || | |
Sbjct: 556 ctgcaagcttttgtgtttgaattcatttccactttccatctcatgtttgcaatttcggga 615
Query: 118 gttgccactgataacagagcgattggtgagatggctgggattgcaattgggtctacatta 177
|| |||| || |||||||| |||||||| |||||||| ||||||||||| |||| ||
Sbjct: 616 gtatccacagacaacagagctattggtgaaatggctggacttgcaattggggctacgata 675
Query: 178 ctgctaaatatattgatttcagggccgatcacaggagcctcaatgaacccagcaagaacc 237
||||||||| | | ||| | || || ||||| ||||| || ||||| |||||||||| |
Sbjct: 676 ctgctaaatgtgataattgccggaccaatcactggagcatcgatgaatccagcaagaagc 735
Query: 238 ctaggacctgctatt 252
||||||||||||||
Sbjct: 736 ttaggacctgctatt 750
>gnl|LJGI|GO039834 similar to UniRef100_Q6QIL2 Cluster: NIP2; n=1; Medicago
truncatula|Rep: NIP2 - Medicago truncatula (Barrel
medic), partial (30%)
Length = 317
Score = 73.8 bits (37), Expect = 7e-13
Identities = 157/197 (79%)
Strand = Plus / Minus
Query: 197 cagggccgatcacaggagcctcaatgaacccagcaagaaccctaggacctgctatttttc 256
||||||| || || ||||| ||||||||||||||||||| | |||| ||||| ||| | |
Sbjct: 274 cagggccaataactggagcatcaatgaacccagcaagaagcataggccctgccattgtgc 215
Query: 257 acagtaaatacagagcaatagtggtatactttgtgtcaactatttttggggctgtggctg 316
| || ||||||||| |||| | ||||||| ||||| | ||| | ||||| |||||||
Sbjct: 214 atggtgaatacagaggaatatggatatacttggtgtctccaattatgggggcagtggctg 155
Query: 317 gagcatgggtcttcaacatcctcagatacacagacaagccattacatgagataaccaagg 376
| |||||||||| ||| ||| | | || || ||||||||||| | |||||| || ||||
Sbjct: 154 gtgcatgggtctacaatatcgttcgctatacggacaagccattgcgtgagatcacaaagg 95
Query: 377 gttcctctatcctcaaa 393
|| ||||| | ||||||
Sbjct: 94 gtgcctcttttctcaaa 78