Miyakogusa Predicted Gene
- Lj4g3v2618240.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2618240.1 Non Chatacterized Hit- tr|I3S2Z2|I3S2Z2_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,99.55,0,Glutathione S-transferase (GST), C-terminal
domain,Glutathione S-transferase, C-terminal-like; Thior,CUFF.51330.1
(672 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64930 similar to UniRef100_Q9FQE4 Cluster: Glutathion... 724 0.0
gnl|LJGI|TC63816 similar to UniRef100_Q9FQE4 Cluster: Glutathion... 295 2e-79
gnl|LJGI|TC72967 weakly similar to UniRef100_Q9FQE4 Cluster: Glu... 88 8e-17
gnl|LJGI|TC57604 weakly similar to UniRef100_Q1RSI2 Cluster: Int... 66 3e-10
gnl|LJGI|FS339365 similar to UniRef100_P32110 Cluster: Probable ... 54 1e-06
gnl|LJGI|DC595214 similar to UniRef100_Q1RSI2 Cluster: Intracell... 54 1e-06
gnl|LJGI|TC66768 similar to UniRef100_P32110 Cluster: Probable g... 54 1e-06
gnl|LJGI|TC63434 similar to UniRef100_P32110 Cluster: Probable g... 54 1e-06
gnl|LJGI|TC59587 similar to UniRef100_P49332 Cluster: Probable g... 52 5e-06
>gnl|LJGI|TC64930 similar to UniRef100_Q9FQE4 Cluster: Glutathione S-transferase GST
14; n=1; Glycine max|Rep: Glutathione S-transferase GST
14 - Glycine max (Soybean), partial (93%)
Length = 864
Score = 724 bits (365), Expect = 0.0
Identities = 368/369 (99%)
Strand = Plus / Plus
Query: 1 atgggaagccaagaggtgcagctgctgaactttttgttgagtccagttggtagaagagtt 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56 atgggaagccaagaggtgcagctgctgaactttttgttgagtccagttggtagaagagtt 115
Query: 61 gaatgggctctaaaactgaagggtgttgattttgagtatgtagaagaagatatcttcaac 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 116 gaatgggctctaaaactgaagggtgttgattttgagtatgtagaagaagatatcttcaac 175
Query: 121 aagagcaatctccttctggaaatgaacccagttcacaagaaggttccggttcttgttcat 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176 aagagcaatctccttctggaaatgaacccagttcacaagaaggttccggttcttgttcat 235
Query: 181 ggccacaaaccaatcgctgagtcactcatcatccttgaatacattgatgaaatatggaag 240
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 236 ggccacaaaccaatcgttgagtcactcatcatccttgaatacattgatgaaatatggaag 295
Query: 241 caatatccactgttacctctgcatccttatgaaagagcacatgctcgcttttgggccaat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 296 caatatccactgttacctctgcatccttatgaaagagcacatgctcgcttttgggccaat 355
Query: 301 ttagctgatgagaagctagcgctgggatcgtgggttgcattaatgcgtagcagcggcgat 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 356 ttagctgatgagaagctagcgctgggatcgtgggttgcattaatgcgtagcagcggcgat 415
Query: 361 gaacaggaa 369
|||||||||
Sbjct: 416 gaacaggaa 424
Score = 466 bits (235), Expect = e-131
Identities = 238/239 (99%)
Strand = Plus / Plus
Query: 434 tctttggaggggacaacattgggtaccttgaccttgtacttggttggatcccttgctggc 493
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 489 tctttggaggggacaacattgggtaccttgaccttgtacttggttggatcccttgctggc 548
Query: 494 ttcctgtttgggaggaagttgggtctatgcaagtacttgacacaaacaaatgtccagcta 553
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 549 ttcctgtttgggaggaagttgggtctatgcaagtacttgacacaaacaaatgtccagcta 608
Query: 554 tctctgcttgggagaccaattttcttagccaccctgttatcaaggactgcttacctccaa 613
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 609 tctctgcttgggggaccaattttcttagccaccctgttatcaaggactgcttacctccaa 668
Query: 614 gggacaagctggttgcttatgcccaccgtcgtagggagcaatatttttctatataatgt 672
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 669 gggacaagctggttgcttatgcccaccgtcgtagggagcaatatttttctatataatgt 727
>gnl|LJGI|TC63816 similar to UniRef100_Q9FQE4 Cluster: Glutathione S-transferase GST
14; n=1; Glycine max|Rep: Glutathione S-transferase GST
14 - Glycine max (Soybean), partial (95%)
Length = 945
Score = 295 bits (149), Expect = 2e-79
Identities = 221/245 (90%)
Strand = Plus / Plus
Query: 58 gttgaatgggctctaaaactgaagggtgttgattttgagtatgtagaagaagatatcttc 117
|||||||||||| | || |||||||||||||| | |||||||||||||||||||||||||
Sbjct: 92 gttgaatgggctttgaagctgaagggtgttgagtatgagtatgtagaagaagatatcttc 151
Query: 118 aacaagagcaatctccttctggaaatgaacccagttcacaagaaggttccggttcttgtt 177
|||||||||| |||||| ||||| ||||||| |||||||||||| |||| |||||||||
Sbjct: 152 aacaagagcagtctcctcctggagttgaacccggttcacaagaagattcccgttcttgtt 211
Query: 178 catggccacaaaccaatcgctgagtcactcatcatccttgaatacattgatgaaatatgg 237
|||||||||||| |||||||||||||| |||| ||| |||||||||||||||| | ||||
Sbjct: 212 catggccacaaaacaatcgctgagtcattcattatcattgaatacattgatgagacatgg 271
Query: 238 aagcaatatccactgttacctctgcatccttatgaaagagcacatgctcgcttttgggcc 297
||||||||||||||||| |||| |||||||||||||||| | ||||||||||||||||
Sbjct: 272 aagcaatatccactgttgcctcatgatccttatgaaagagctcttgctcgcttttgggcc 331
Query: 298 aattt 302
|||||
Sbjct: 332 aattt 336
Score = 95.6 bits (48), Expect = 3e-19
Identities = 153/188 (81%)
Strand = Plus / Plus
Query: 434 tctttggaggggacaacattgggtaccttgaccttgtacttggttggatcccttgctggc 493
||||||||||||| || ||||||||||||||| ||| | |||| |||||| ||| ||||
Sbjct: 465 tctttggaggggaaaatattgggtaccttgacattgcagttggatggatctcttactgga 524
Query: 494 ttcctgtttgggaggaagttgggtctatgcaagtacttgacacaaacaaatgtccagcta 553
||| | |||||||||||||||||||||| || || | ||| || |||| |||||| |
Sbjct: 525 ttcatatttgggaggaagttgggtctattcacataatagacccattgaaatttccagcca 584
Query: 554 tctctgcttgggagaccaattttcttagccaccctgttatcaaggactgcttacctccaa 613
| |||| ||| |||||| ||||| ||||||||||| ||||||||| ||| || ||||
Sbjct: 585 ccactgcatggatgaccaactttctcagccaccctgtaatcaaggacaccttgcccccaa 644
Query: 614 gggacaag 621
| ||||||
Sbjct: 645 gagacaag 652
>gnl|LJGI|TC72967 weakly similar to UniRef100_Q9FQE4 Cluster: Glutathione
S-transferase GST 14; n=1; Glycine max|Rep: Glutathione
S-transferase GST 14 - Glycine max (Soybean), partial
(49%)
Length = 517
Score = 87.7 bits (44), Expect = 8e-17
Identities = 71/80 (88%)
Strand = Plus / Plus
Query: 442 ggggacaacattgggtaccttgaccttgtacttggttggatcccttgctggcttcctgtt 501
||||| |||||||| ||||||||||||| | |||||||| || ||| |||| || |||||
Sbjct: 151 ggggataacattggctaccttgaccttgcaattggttggttctcttactggatttctgtt 210
Query: 502 tgggaggaagttgggtctat 521
||||||||||||||||||||
Sbjct: 211 tgggaggaagttgggtctat 230
>gnl|LJGI|TC57604 weakly similar to UniRef100_Q1RSI2 Cluster: Intracellular chloride
channel; n=1; Medicago truncatula|Rep: Intracellular
chloride channel - Medicago truncatula (Barrel medic),
partial (84%)
Length = 860
Score = 65.9 bits (33), Expect = 3e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 145 aacccagttcacaagaaggttccggttcttgttcatg 181
|||||||||||||||||||||||||| ||||||||||
Sbjct: 161 aacccagttcacaagaaggttccggtgcttgttcatg 197
>gnl|LJGI|FS339365 similar to UniRef100_P32110 Cluster: Probable glutathione
S-transferase; n=1; Glycine max|Rep: Probable
glutathione S-transferase - Glycine max (Soybean),
partial (92%)
Length = 786
Score = 54.0 bits (27), Expect = 1e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 145 aacccagttcacaagaaggttccggttcttgttca 179
||||||||||||||||||||||| || ||||||||
Sbjct: 174 aacccagttcacaagaaggttcctgtgcttgttca 208
>gnl|LJGI|DC595214 similar to UniRef100_Q1RSI2 Cluster: Intracellular chloride
channel; n=1; Medicago truncatula|Rep: Intracellular
chloride channel - Medicago truncatula (Barrel medic),
partial (42%)
Length = 358
Score = 54.0 bits (27), Expect = 1e-06
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 151 gttcacaagaaggttccggttcttgttcatg 181
|||||||||||||||||||| ||||||||||
Sbjct: 130 gttcacaagaaggttccggtgcttgttcatg 160
>gnl|LJGI|TC66768 similar to UniRef100_P32110 Cluster: Probable glutathione
S-transferase; n=1; Glycine max|Rep: Probable
glutathione S-transferase - Glycine max (Soybean),
complete
Length = 798
Score = 54.0 bits (27), Expect = 1e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 145 aacccagttcacaagaaggttccggttcttgttca 179
||||||||||||||||||||||| || ||||||||
Sbjct: 206 aacccagttcacaagaaggttcctgtgcttgttca 240
>gnl|LJGI|TC63434 similar to UniRef100_P32110 Cluster: Probable glutathione
S-transferase; n=1; Glycine max|Rep: Probable
glutathione S-transferase - Glycine max (Soybean),
partial (85%)
Length = 914
Score = 54.0 bits (27), Expect = 1e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 145 aacccagttcacaagaaggttccggttcttgttca 179
||||||||||||||||||||||| || ||||||||
Sbjct: 56 aacccagttcacaagaaggttcctgtgcttgttca 90
>gnl|LJGI|TC59587 similar to UniRef100_P49332 Cluster: Probable glutathione
S-transferase parC; n=1; Nicotiana tabacum|Rep: Probable
glutathione S-transferase parC - Nicotiana tabacum
(Common tobacco), partial (95%)
Length = 885
Score = 52.0 bits (26), Expect = 5e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 133 cttctggaaatgaacccagttcacaagaag 162
|||||||||||||||||| |||||||||||
Sbjct: 224 cttctggaaatgaacccaattcacaagaag 253