Miyakogusa Predicted Gene

Lj4g3v2618240.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2618240.1 Non Chatacterized Hit- tr|I3S2Z2|I3S2Z2_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,99.55,0,Glutathione S-transferase (GST), C-terminal
domain,Glutathione S-transferase, C-terminal-like; Thior,CUFF.51330.1
         (672 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64930 similar to UniRef100_Q9FQE4 Cluster: Glutathion...   724   0.0  
gnl|LJGI|TC63816 similar to UniRef100_Q9FQE4 Cluster: Glutathion...   295   2e-79
gnl|LJGI|TC72967 weakly similar to UniRef100_Q9FQE4 Cluster: Glu...    88   8e-17
gnl|LJGI|TC57604 weakly similar to UniRef100_Q1RSI2 Cluster: Int...    66   3e-10
gnl|LJGI|FS339365 similar to UniRef100_P32110 Cluster: Probable ...    54   1e-06
gnl|LJGI|DC595214 similar to UniRef100_Q1RSI2 Cluster: Intracell...    54   1e-06
gnl|LJGI|TC66768 similar to UniRef100_P32110 Cluster: Probable g...    54   1e-06
gnl|LJGI|TC63434 similar to UniRef100_P32110 Cluster: Probable g...    54   1e-06
gnl|LJGI|TC59587 similar to UniRef100_P49332 Cluster: Probable g...    52   5e-06

>gnl|LJGI|TC64930 similar to UniRef100_Q9FQE4 Cluster: Glutathione S-transferase GST
           14; n=1; Glycine max|Rep: Glutathione S-transferase GST
           14 - Glycine max (Soybean), partial (93%)
          Length = 864

 Score =  724 bits (365), Expect = 0.0
 Identities = 368/369 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaagccaagaggtgcagctgctgaactttttgttgagtccagttggtagaagagtt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56  atgggaagccaagaggtgcagctgctgaactttttgttgagtccagttggtagaagagtt 115

                                                                       
Query: 61  gaatgggctctaaaactgaagggtgttgattttgagtatgtagaagaagatatcttcaac 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 116 gaatgggctctaaaactgaagggtgttgattttgagtatgtagaagaagatatcttcaac 175

                                                                       
Query: 121 aagagcaatctccttctggaaatgaacccagttcacaagaaggttccggttcttgttcat 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176 aagagcaatctccttctggaaatgaacccagttcacaagaaggttccggttcttgttcat 235

                                                                       
Query: 181 ggccacaaaccaatcgctgagtcactcatcatccttgaatacattgatgaaatatggaag 240
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 236 ggccacaaaccaatcgttgagtcactcatcatccttgaatacattgatgaaatatggaag 295

                                                                       
Query: 241 caatatccactgttacctctgcatccttatgaaagagcacatgctcgcttttgggccaat 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 296 caatatccactgttacctctgcatccttatgaaagagcacatgctcgcttttgggccaat 355

                                                                       
Query: 301 ttagctgatgagaagctagcgctgggatcgtgggttgcattaatgcgtagcagcggcgat 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 356 ttagctgatgagaagctagcgctgggatcgtgggttgcattaatgcgtagcagcggcgat 415

                    
Query: 361 gaacaggaa 369
           |||||||||
Sbjct: 416 gaacaggaa 424



 Score =  466 bits (235), Expect = e-131
 Identities = 238/239 (99%)
 Strand = Plus / Plus

                                                                       
Query: 434 tctttggaggggacaacattgggtaccttgaccttgtacttggttggatcccttgctggc 493
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 489 tctttggaggggacaacattgggtaccttgaccttgtacttggttggatcccttgctggc 548

                                                                       
Query: 494 ttcctgtttgggaggaagttgggtctatgcaagtacttgacacaaacaaatgtccagcta 553
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 549 ttcctgtttgggaggaagttgggtctatgcaagtacttgacacaaacaaatgtccagcta 608

                                                                       
Query: 554 tctctgcttgggagaccaattttcttagccaccctgttatcaaggactgcttacctccaa 613
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 609 tctctgcttgggggaccaattttcttagccaccctgttatcaaggactgcttacctccaa 668

                                                                      
Query: 614 gggacaagctggttgcttatgcccaccgtcgtagggagcaatatttttctatataatgt 672
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 669 gggacaagctggttgcttatgcccaccgtcgtagggagcaatatttttctatataatgt 727


>gnl|LJGI|TC63816 similar to UniRef100_Q9FQE4 Cluster: Glutathione S-transferase GST
           14; n=1; Glycine max|Rep: Glutathione S-transferase GST
           14 - Glycine max (Soybean), partial (95%)
          Length = 945

 Score =  295 bits (149), Expect = 2e-79
 Identities = 221/245 (90%)
 Strand = Plus / Plus

                                                                       
Query: 58  gttgaatgggctctaaaactgaagggtgttgattttgagtatgtagaagaagatatcttc 117
           |||||||||||| | || |||||||||||||| | |||||||||||||||||||||||||
Sbjct: 92  gttgaatgggctttgaagctgaagggtgttgagtatgagtatgtagaagaagatatcttc 151

                                                                       
Query: 118 aacaagagcaatctccttctggaaatgaacccagttcacaagaaggttccggttcttgtt 177
           |||||||||| |||||| |||||  ||||||| |||||||||||| |||| |||||||||
Sbjct: 152 aacaagagcagtctcctcctggagttgaacccggttcacaagaagattcccgttcttgtt 211

                                                                       
Query: 178 catggccacaaaccaatcgctgagtcactcatcatccttgaatacattgatgaaatatgg 237
           |||||||||||| |||||||||||||| |||| ||| |||||||||||||||| | ||||
Sbjct: 212 catggccacaaaacaatcgctgagtcattcattatcattgaatacattgatgagacatgg 271

                                                                       
Query: 238 aagcaatatccactgttacctctgcatccttatgaaagagcacatgctcgcttttgggcc 297
           ||||||||||||||||| ||||   |||||||||||||||| | ||||||||||||||||
Sbjct: 272 aagcaatatccactgttgcctcatgatccttatgaaagagctcttgctcgcttttgggcc 331

                
Query: 298 aattt 302
           |||||
Sbjct: 332 aattt 336



 Score = 95.6 bits (48), Expect = 3e-19
 Identities = 153/188 (81%)
 Strand = Plus / Plus

                                                                       
Query: 434 tctttggaggggacaacattgggtaccttgaccttgtacttggttggatcccttgctggc 493
           ||||||||||||| || ||||||||||||||| ||| | |||| |||||| ||| |||| 
Sbjct: 465 tctttggaggggaaaatattgggtaccttgacattgcagttggatggatctcttactgga 524

                                                                       
Query: 494 ttcctgtttgggaggaagttgggtctatgcaagtacttgacacaaacaaatgtccagcta 553
           ||| | |||||||||||||||||||||| ||  || | ||| ||   |||| |||||| |
Sbjct: 525 ttcatatttgggaggaagttgggtctattcacataatagacccattgaaatttccagcca 584

                                                                       
Query: 554 tctctgcttgggagaccaattttcttagccaccctgttatcaaggactgcttacctccaa 613
            | |||| |||  |||||| ||||| ||||||||||| |||||||||  ||| || ||||
Sbjct: 585 ccactgcatggatgaccaactttctcagccaccctgtaatcaaggacaccttgcccccaa 644

                   
Query: 614 gggacaag 621
           | ||||||
Sbjct: 645 gagacaag 652


>gnl|LJGI|TC72967 weakly similar to UniRef100_Q9FQE4 Cluster: Glutathione
           S-transferase GST 14; n=1; Glycine max|Rep: Glutathione
           S-transferase GST 14 - Glycine max (Soybean), partial
           (49%)
          Length = 517

 Score = 87.7 bits (44), Expect = 8e-17
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                       
Query: 442 ggggacaacattgggtaccttgaccttgtacttggttggatcccttgctggcttcctgtt 501
           ||||| |||||||| ||||||||||||| | |||||||| || ||| |||| || |||||
Sbjct: 151 ggggataacattggctaccttgaccttgcaattggttggttctcttactggatttctgtt 210

                               
Query: 502 tgggaggaagttgggtctat 521
           ||||||||||||||||||||
Sbjct: 211 tgggaggaagttgggtctat 230


>gnl|LJGI|TC57604 weakly similar to UniRef100_Q1RSI2 Cluster: Intracellular chloride
           channel; n=1; Medicago truncatula|Rep: Intracellular
           chloride channel - Medicago truncatula (Barrel medic),
           partial (84%)
          Length = 860

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 145 aacccagttcacaagaaggttccggttcttgttcatg 181
           |||||||||||||||||||||||||| ||||||||||
Sbjct: 161 aacccagttcacaagaaggttccggtgcttgttcatg 197


>gnl|LJGI|FS339365 similar to UniRef100_P32110 Cluster: Probable glutathione
           S-transferase; n=1; Glycine max|Rep: Probable
           glutathione S-transferase - Glycine max (Soybean),
           partial (92%)
          Length = 786

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 145 aacccagttcacaagaaggttccggttcttgttca 179
           ||||||||||||||||||||||| || ||||||||
Sbjct: 174 aacccagttcacaagaaggttcctgtgcttgttca 208


>gnl|LJGI|DC595214 similar to UniRef100_Q1RSI2 Cluster: Intracellular chloride
           channel; n=1; Medicago truncatula|Rep: Intracellular
           chloride channel - Medicago truncatula (Barrel medic),
           partial (42%)
          Length = 358

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 151 gttcacaagaaggttccggttcttgttcatg 181
           |||||||||||||||||||| ||||||||||
Sbjct: 130 gttcacaagaaggttccggtgcttgttcatg 160


>gnl|LJGI|TC66768 similar to UniRef100_P32110 Cluster: Probable glutathione
           S-transferase; n=1; Glycine max|Rep: Probable
           glutathione S-transferase - Glycine max (Soybean),
           complete
          Length = 798

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 145 aacccagttcacaagaaggttccggttcttgttca 179
           ||||||||||||||||||||||| || ||||||||
Sbjct: 206 aacccagttcacaagaaggttcctgtgcttgttca 240


>gnl|LJGI|TC63434 similar to UniRef100_P32110 Cluster: Probable glutathione
           S-transferase; n=1; Glycine max|Rep: Probable
           glutathione S-transferase - Glycine max (Soybean),
           partial (85%)
          Length = 914

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 145 aacccagttcacaagaaggttccggttcttgttca 179
           ||||||||||||||||||||||| || ||||||||
Sbjct: 56  aacccagttcacaagaaggttcctgtgcttgttca 90


>gnl|LJGI|TC59587 similar to UniRef100_P49332 Cluster: Probable glutathione
           S-transferase parC; n=1; Nicotiana tabacum|Rep: Probable
           glutathione S-transferase parC - Nicotiana tabacum
           (Common tobacco), partial (95%)
          Length = 885

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 133 cttctggaaatgaacccagttcacaagaag 162
           |||||||||||||||||| |||||||||||
Sbjct: 224 cttctggaaatgaacccaattcacaagaag 253