Miyakogusa Predicted Gene
- Lj4g3v2604650.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2604650.1 Non Chatacterized Hit- tr|C6SXW0|C6SXW0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.25610
PE,86.81,0,DUF640,Domain of unknown function DUF640; seg,NULL; FAMILY
NOT NAMED,NULL,CUFF.51301.1
(530 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC61313 74 1e-12
gnl|LJGI|BW595790 58 6e-08
>gnl|LJGI|TC61313
Length = 777
Score = 73.8 bits (37), Expect = 1e-12
Identities = 94/113 (83%)
Strand = Plus / Plus
Query: 154 tggaacacctttgggcaatacttgaagaataggactccccaagttccactctctcagtgc 213
|||||||| |||||||| |||||||| || || |||| ||||||||| |||||||||
Sbjct: 159 tggaacacttttgggcagtacttgaataaccagagacccccagttccactttctcagtgc 218
Query: 214 aacttcaaccatgttcttgatttccttcgctaccttgaccaatttgggaagac 266
|| ||||||||||| | || || ||| | ||||| |||||||||||||||||
Sbjct: 219 aatttcaaccatgtcatggaatttcttaggtacctagaccaatttgggaagac 271
>gnl|LJGI|BW595790
Length = 478
Score = 58.0 bits (29), Expect = 6e-08
Identities = 80/97 (82%)
Strand = Plus / Plus
Query: 199 ccactctctcagtgcaacttcaaccatgttcttgatttccttcgctaccttgaccaattt 258
|||||||| ||||||||| |||||| || | |||||||| || ||||||||||| ||
Sbjct: 199 ccactctccgagtgcaactgcaaccacgtcttggatttcctccgttaccttgaccagttc 258
Query: 259 gggaagactaaggtccactcgcacggttgcatcttct 295
|||||||| ||||| ||| ||| |||||||| ||||
Sbjct: 259 gggaagaccaaggttcacctgcaaggttgcatgttct 295