Miyakogusa Predicted Gene

Lj4g3v2593480.3
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2593480.3 CUFF.51232.3
         (402 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BF177754 weakly similar to UniRef100_Q1ZXD6 Cluster: Pl...   299   7e-81

>gnl|LJGI|BF177754 weakly similar to UniRef100_Q1ZXD6 Cluster: Pleckstrin homology
           (PH) domain-containing protein; n=1; Dictyostelium
           discoideum|Rep:, partial (1%)
          Length = 416

 Score =  299 bits (151), Expect = 7e-81
 Identities = 151/151 (100%)
 Strand = Plus / Plus

                                                                       
Query: 252 taaaatcagtactgcagatgacaaaggattttctggacaaggtggggatcacaatgtatc 311
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 218 taaaatcagtactgcagatgacaaaggattttctggacaaggtggggatcacaatgtatc 277

                                                                       
Query: 312 tagtatcccaaaggaaatcaagcaaagtggtaataagggtatcttgtttgagaataaact 371
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 278 tagtatcccaaaggaaatcaagcaaagtggtaataagggtatcttgtttgagaataaact 337

                                          
Query: 372 tgtcaaacagtatcctggtaacaatggggag 402
           |||||||||||||||||||||||||||||||
Sbjct: 338 tgtcaaacagtatcctggtaacaatggggag 368