Miyakogusa Predicted Gene

Lj4g3v2593480.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2593480.1 Non Chatacterized Hit- tr|F6I752|F6I752_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,44.03,1e-17,seg,NULL; coiled-coil,NULL,CUFF.51232.1
         (1434 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BF177754 weakly similar to UniRef100_Q1ZXD6 Cluster: Pl...   325   4e-88

>gnl|LJGI|BF177754 weakly similar to UniRef100_Q1ZXD6 Cluster: Pleckstrin homology
           (PH) domain-containing protein; n=1; Dictyostelium
           discoideum|Rep:, partial (1%)
          Length = 416

 Score =  325 bits (164), Expect = 4e-88
 Identities = 164/164 (100%)
 Strand = Plus / Plus

                                                                       
Query: 252 taaaatcagtactgcagatgacaaaggattttctggacaaggtggggatcacaatgtatc 311
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 218 taaaatcagtactgcagatgacaaaggattttctggacaaggtggggatcacaatgtatc 277

                                                                       
Query: 312 tagtatcccaaaggaaatcaagcaaagtggtaataagggtatcttgtttgagaataaact 371
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 278 tagtatcccaaaggaaatcaagcaaagtggtaataagggtatcttgtttgagaataaact 337

                                                       
Query: 372 tgtcaaacagtatcctggtaacaatggggagagtgctagagaga 415
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 338 tgtcaaacagtatcctggtaacaatggggagagtgctagagaga 381