Miyakogusa Predicted Gene

Lj4g3v2578300.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2578300.2 tr|G7LH38|G7LH38_MEDTR Subtilisin-like protease
OS=Medicago truncatula GN=MTR_8g083220 PE=4
SV=1,81.18,0,SUBTILISIN,Peptidase S8, subtilisin-related; no
description,NULL; no description,Peptidase S8/S53, s,CUFF.51177.2
         (2343 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79460 similar to UniRef100_Q6WNU4 Cluster: Subtilisin...    54   4e-06

>gnl|LJGI|TC79460 similar to UniRef100_Q6WNU4 Cluster: Subtilisin-like protease; n=2;
            Glycine max|Rep: Subtilisin-like protease - Glycine max
            (Soybean), partial (40%)
          Length = 1250

 Score = 54.0 bits (27), Expect = 4e-06
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                   
Query: 2279 cagatggcaagcattttgtgaggaccccaatagttgtga 2317
            ||||||||||||||| ||||||||  |||||||||||||
Sbjct: 982  cagatggcaagcattatgtgaggagtccaatagttgtga 1020