Miyakogusa Predicted Gene
- Lj4g3v2573940.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2573940.1 Non Chatacterized Hit- tr|I1K3P5|I1K3P5_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,88.3,2e-38,Sm-like
ribonucleoproteins,Like-Sm (LSM) domain; snRNP Sm
proteins,Ribonucleoprotein LSM domain, euk,CUFF.51149.1
(285 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC70953 homologue to UniRef100_A7QWV4 Cluster: Chromoso... 248 2e-65
>gnl|LJGI|TC70953 homologue to UniRef100_A7QWV4 Cluster: Chromosome chr13
scaffold_210, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr13 scaffold_210, whole
genome shotgun sequence - Vitis vinifera (Grape),
partial (87%)
Length = 654
Score = 248 bits (125), Expect = 2e-65
Identities = 224/257 (87%)
Strand = Plus / Plus
Query: 1 atgtcaggcagaaaagaaacagttctggaccttgcaaagtttgtggacaaaggtgttcaa 60
|||||||| || |||||||| ||||||||| | || || || || |||||||||||||||
Sbjct: 193 atgtcagggaggaaagaaacggttctggacttggccaaattcgttgacaaaggtgttcaa 252
Query: 61 gtgaagcttactggtggcagacaagtgacagggactctaaaaggctatgatcagttactt 120
|| ||||| ||||||||||||||||||||||| ||||| ||||| ||||| ||||||||
Sbjct: 253 gttaagctcactggtggcagacaagtgacaggaactctgaaagggtatgaccagttacta 312
Query: 121 aaccttgtcctagatgaagccgtagagtttttaagagatcctgatgatcctctccaaatt 180
||||||||||| |||||||| || || ||| | ||||||||||||||||| || ||| |
Sbjct: 313 aaccttgtcctggatgaagctgttgaatttctgagagatcctgatgatccactgaaaact 372
Query: 181 actgatcagaccagacatcttggctttattgtttgtagaggaactgccgttatgcttgtt 240
|| | |||||||||| ||||||||| |||||||||||||||||||| || |||||||||
Sbjct: 373 acagctcagaccagaagtcttggcttaattgtttgtagaggaactgctgtcatgcttgtt 432
Query: 241 tccccaactgatggtac 257
|||||||||||||||||
Sbjct: 433 tccccaactgatggtac 449