Miyakogusa Predicted Gene

Lj4g3v2526000.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2526000.1 Non Chatacterized Hit- tr|I1K3J5|I1K3J5_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.19087 PE,74.56,0,FAMILY
NOT NAMED,NULL; Ankyrin repeat,Ankyrin repeat-containing domain; no
description,Ankyrin repea,CUFF.51095.1
         (2016 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63017 homologue to UniRef100_A7PLU3 Cluster: Chromoso...    86   1e-15

>gnl|LJGI|TC63017 homologue to UniRef100_A7PLU3 Cluster: Chromosome chr14
           scaffold_21, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr14 scaffold_21, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (10%)
          Length = 821

 Score = 85.7 bits (43), Expect = 1e-15
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 19  cctcttcgttgggagagtacaggagacaagtggtggtatgcatctcctattgattatgct 78
           ||||||||||||||||| || || ||| |||||||||||||||| ||||| |||||||||
Sbjct: 682 cctcttcgttgggagagcactggggaccagtggtggtatgcatcacctatagattatgct 741

                      
Query: 79  gctgcaaatgg 89
           ||||| |||||
Sbjct: 742 gctgctaatgg 752