Miyakogusa Predicted Gene

Lj4g3v2376150.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2376150.1 Non Chatacterized Hit- tr|I1KWK0|I1KWK0_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,38.04,3e-17,
,CUFF.50886.1
         (506 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC71340 UniRef100_Q8VDV5 Cluster: Dmxl1 protein; n=1; M...    90   2e-17

>gnl|LJGI|TC71340 UniRef100_Q8VDV5 Cluster: Dmxl1 protein; n=1; Mus musculus|Rep:
           Dmxl1 protein - Mus musculus (Mouse), partial (29%)
          Length = 530

 Score = 89.7 bits (45), Expect = 2e-17
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                            
Query: 454 tactttccacatcattatatgtatagagagagtttgctaccactccctt 502
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 1   tactttccacatccttatatgtatagagagagtttgctaccactccctt 49