Miyakogusa Predicted Gene

Lj4g3v2373730.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2373730.2 tr|G7JJ26|G7JJ26_MEDTR Sodium/hydrogen exchanger
OS=Medicago truncatula GN=MTR_4g118770 PE=4
SV=1,81.97,0,Na_H_Exchanger,Cation/H+ exchanger; NAHEXCHNGR,Na+/H+
exchanger; Q30KS2_CANFA_Q30KS2;,NULL; SODIUM/H,CUFF.50865.2
         (756 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77065 homologue to UniRef100_Q0IJ87 Cluster: Sodium/h...   100   2e-20

>gnl|LJGI|TC77065 homologue to UniRef100_Q0IJ87 Cluster: Sodium/hydrogen exchanger;
           n=1; Glycine max|Rep: Sodium/hydrogen exchanger -
           Glycine max (Soybean), partial (36%)
          Length = 591

 Score = 99.6 bits (50), Expect = 2e-20
 Identities = 104/122 (85%)
 Strand = Plus / Plus

                                                                       
Query: 445 ctagcaattggagcaatattttctgcaacagattctgtttgcacattgcaggttcttaat 504
           ||||||||||| ||||||||| |||| ||||||||||||||||||||||||||  | |||
Sbjct: 68  ctagcaattggtgcaatatttgctgctacagattctgtttgcacattgcaggtgttaaat 127

                                                                       
Query: 505 caggatacaacacctttactatacagcctggtctttggggagggggtagtaaatgatgct 564
           || |||   |||||||| || ||||| || || ||||||||||| || || |||||||||
Sbjct: 128 caagatgagacacctttgctgtacagtcttgtatttggggagggtgttgtgaatgatgct 187

             
Query: 565 ac 566
           ||
Sbjct: 188 ac 189