Miyakogusa Predicted Gene

Lj4g3v2366260.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2366260.1 Non Chatacterized Hit- tr|I3SKE1|I3SKE1_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,76.67,0.000005,
,CUFF.50812.1
         (277 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS340477 weakly similar to UniRef100_Q711G8 Cluster: Cu...   121   2e-27
gnl|LJGI|GO006990 weakly similar to UniRef100_Q711G8 Cluster: Cu...   121   2e-27
gnl|LJGI|FS330305 weakly similar to UniRef100_UPI000016318F Clus...    62   2e-09
gnl|LJGI|FS330777 weakly similar to UniRef100_Q94AH6 Cluster: Cu...    60   7e-09
gnl|LJGI|TC64875 weakly similar to UniRef100_Q8LP18 Cluster: Cul...    60   7e-09

>gnl|LJGI|FS340477 weakly similar to UniRef100_Q711G8 Cluster: Cullin 1A; n=1;
           Nicotiana tabacum|Rep: Cullin 1A - Nicotiana tabacum
           (Common tobacco), partial (8%)
          Length = 727

 Score =  121 bits (61), Expect = 2e-27
 Identities = 79/85 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtgtacagaccaaatgggtgctcataattgccagctgctctatggcagatataaggag 60
           |||||||||| |||| |||||| ||| |||||| ||||||||||||||||||||||||||
Sbjct: 449 atgtgtacaggccaactgggtgatcagaattgcaagctgctctatggcagatataaggag 508

                                    
Query: 61  gtctttgagaaatatatcaattcca 85
           |||||||||| ||||||||||||||
Sbjct: 509 gtctttgagacatatatcaattcca 533


>gnl|LJGI|GO006990 weakly similar to UniRef100_Q711G8 Cluster: Cullin 1A; n=1;
           Nicotiana tabacum|Rep: Cullin 1A - Nicotiana tabacum
           (Common tobacco), partial (8%)
          Length = 689

 Score =  121 bits (61), Expect = 2e-27
 Identities = 79/85 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtgtacagaccaaatgggtgctcataattgccagctgctctatggcagatataaggag 60
           |||||||||| |||| |||||| ||| |||||| ||||||||||||||||||||||||||
Sbjct: 466 atgtgtacaggccaactgggtgatcagaattgcaagctgctctatggcagatataaggag 525

                                    
Query: 61  gtctttgagaaatatatcaattcca 85
           |||||||||| ||||||||||||||
Sbjct: 526 gtctttgagacatatatcaattcca 550


>gnl|LJGI|FS330305 weakly similar to UniRef100_UPI000016318F Cluster: cullin-related;
           n=1; Arabidopsis thaliana|Rep: cullin-related -
           Arabidopsis thaliana, partial (7%)
          Length = 762

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 28  aattgccagctgctctatggcagatataaggaggtctttgagaaatatatcaattccata 87
           |||||| |||| ||||||| || ||||||| ||||||||||  ||||||||||||||| |
Sbjct: 270 aattgcgagctactctatgccaaatataagaaggtctttgaagaatatatcaattccaca 329

              
Query: 88  gta 90
           |||
Sbjct: 330 gta 332


>gnl|LJGI|FS330777 weakly similar to UniRef100_Q94AH6 Cluster: Cullin-1; n=2;
           Arabidopsis thaliana|Rep: Cullin-1 - Arabidopsis
           thaliana (Mouse-ear cress), partial (4%)
          Length = 757

 Score = 60.0 bits (30), Expect = 7e-09
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 28  aattgccagctgctctatggcagatataaggaggtctttgagaaatatatcaattcca 85
           |||||| |||| ||||||| || ||||||| ||||||||||  |||||||||||||||
Sbjct: 643 aattgcgagctactctatgccaaatataagaaggtctttgaagaatatatcaattcca 700


>gnl|LJGI|TC64875 weakly similar to UniRef100_Q8LP18 Cluster: Cullin-like protein1;
           n=1; Pisum sativum|Rep: Cullin-like protein1 - Pisum
           sativum (Garden pea), partial (17%)
          Length = 1353

 Score = 60.0 bits (30), Expect = 7e-09
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 28  aattgccagctgctctatggcagatataaggaggtctttgagaaatatatcaattcca 85
           |||||| |||| ||||||| || ||||||| ||||||||||  |||||||||||||||
Sbjct: 271 aattgcgagctactctatgccaaatataagaaggtctttgaagaatatatcaattcca 328