Miyakogusa Predicted Gene
- Lj4g3v2366260.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2366260.1 Non Chatacterized Hit- tr|I3SKE1|I3SKE1_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2 SV=1,76.67,0.000005,
,CUFF.50812.1
(277 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS340477 weakly similar to UniRef100_Q711G8 Cluster: Cu... 121 2e-27
gnl|LJGI|GO006990 weakly similar to UniRef100_Q711G8 Cluster: Cu... 121 2e-27
gnl|LJGI|FS330305 weakly similar to UniRef100_UPI000016318F Clus... 62 2e-09
gnl|LJGI|FS330777 weakly similar to UniRef100_Q94AH6 Cluster: Cu... 60 7e-09
gnl|LJGI|TC64875 weakly similar to UniRef100_Q8LP18 Cluster: Cul... 60 7e-09
>gnl|LJGI|FS340477 weakly similar to UniRef100_Q711G8 Cluster: Cullin 1A; n=1;
Nicotiana tabacum|Rep: Cullin 1A - Nicotiana tabacum
(Common tobacco), partial (8%)
Length = 727
Score = 121 bits (61), Expect = 2e-27
Identities = 79/85 (92%)
Strand = Plus / Plus
Query: 1 atgtgtacagaccaaatgggtgctcataattgccagctgctctatggcagatataaggag 60
|||||||||| |||| |||||| ||| |||||| ||||||||||||||||||||||||||
Sbjct: 449 atgtgtacaggccaactgggtgatcagaattgcaagctgctctatggcagatataaggag 508
Query: 61 gtctttgagaaatatatcaattcca 85
|||||||||| ||||||||||||||
Sbjct: 509 gtctttgagacatatatcaattcca 533
>gnl|LJGI|GO006990 weakly similar to UniRef100_Q711G8 Cluster: Cullin 1A; n=1;
Nicotiana tabacum|Rep: Cullin 1A - Nicotiana tabacum
(Common tobacco), partial (8%)
Length = 689
Score = 121 bits (61), Expect = 2e-27
Identities = 79/85 (92%)
Strand = Plus / Plus
Query: 1 atgtgtacagaccaaatgggtgctcataattgccagctgctctatggcagatataaggag 60
|||||||||| |||| |||||| ||| |||||| ||||||||||||||||||||||||||
Sbjct: 466 atgtgtacaggccaactgggtgatcagaattgcaagctgctctatggcagatataaggag 525
Query: 61 gtctttgagaaatatatcaattcca 85
|||||||||| ||||||||||||||
Sbjct: 526 gtctttgagacatatatcaattcca 550
>gnl|LJGI|FS330305 weakly similar to UniRef100_UPI000016318F Cluster: cullin-related;
n=1; Arabidopsis thaliana|Rep: cullin-related -
Arabidopsis thaliana, partial (7%)
Length = 762
Score = 61.9 bits (31), Expect = 2e-09
Identities = 55/63 (87%)
Strand = Plus / Plus
Query: 28 aattgccagctgctctatggcagatataaggaggtctttgagaaatatatcaattccata 87
|||||| |||| ||||||| || ||||||| |||||||||| ||||||||||||||| |
Sbjct: 270 aattgcgagctactctatgccaaatataagaaggtctttgaagaatatatcaattccaca 329
Query: 88 gta 90
|||
Sbjct: 330 gta 332
>gnl|LJGI|FS330777 weakly similar to UniRef100_Q94AH6 Cluster: Cullin-1; n=2;
Arabidopsis thaliana|Rep: Cullin-1 - Arabidopsis
thaliana (Mouse-ear cress), partial (4%)
Length = 757
Score = 60.0 bits (30), Expect = 7e-09
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 28 aattgccagctgctctatggcagatataaggaggtctttgagaaatatatcaattcca 85
|||||| |||| ||||||| || ||||||| |||||||||| |||||||||||||||
Sbjct: 643 aattgcgagctactctatgccaaatataagaaggtctttgaagaatatatcaattcca 700
>gnl|LJGI|TC64875 weakly similar to UniRef100_Q8LP18 Cluster: Cullin-like protein1;
n=1; Pisum sativum|Rep: Cullin-like protein1 - Pisum
sativum (Garden pea), partial (17%)
Length = 1353
Score = 60.0 bits (30), Expect = 7e-09
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 28 aattgccagctgctctatggcagatataaggaggtctttgagaaatatatcaattcca 85
|||||| |||| ||||||| || ||||||| |||||||||| |||||||||||||||
Sbjct: 271 aattgcgagctactctatgccaaatataagaaggtctttgaagaatatatcaattcca 328