Miyakogusa Predicted Gene

Lj4g3v2294490.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2294490.1 Non Chatacterized Hit- tr|C6DE87|C6DE87_PECCP
Putative uncharacterized protein OS=Pectobacterium
car,33.65,0.17,seg,NULL,gene.g56626.t1.1
         (480 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS344327                                                      64   8e-10

>gnl|LJGI|FS344327 
          Length = 693

 Score = 63.9 bits (32), Expect = 8e-10
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 352 attggaattgcaacattggcactacacagctctgaagacctccatatcattgttgaagtt 411
           ||||||||||||| |||||| ||  ||| || ||| ||| ||||| ||||||||||||||
Sbjct: 295 attggaattgcaatattggctcttaacaactatgaggacatccatgtcattgttgaagtt 354

                       
Query: 412 gctgctcttcaa 423
           |||| |||||||
Sbjct: 355 gctggtcttcaa 366