Miyakogusa Predicted Gene

Lj4g3v2267520.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2267520.1 Non Chatacterized Hit- tr|I1KMR6|I1KMR6_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.45518 PE,66.67,0.17,
,CUFF.50697.1
         (126 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS330097 similar to UniRef100_A2Q2X1 Cluster: Aldehyde ...    68   1e-11

>gnl|LJGI|FS330097 similar to UniRef100_A2Q2X1 Cluster: Aldehyde dehydrogenase; n=1;
           Medicago truncatula|Rep: Aldehyde dehydrogenase -
           Medicago truncatula (Barrel medic), partial (27%)
          Length = 666

 Score = 67.9 bits (34), Expect = 1e-11
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 34  gcattcgcttacggtacctacgggttccttctcatgatcattcctcccaa 83
           |||||||||||||||| || | |||||||||||||| |||||||||||||
Sbjct: 217 gcattcgcttacggtatctgcaggttccttctcatgctcattcctcccaa 266