Miyakogusa Predicted Gene

Lj4g3v2267350.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2267350.1 CUFF.50646.1
         (499 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81904 similar to UniRef100_A2STI6 Cluster: Prefoldin,...    92   4e-18

>gnl|LJGI|TC81904 similar to UniRef100_A2STI6 Cluster: Prefoldin, alpha subunit; n=1;
           Methanocorpusculum labreanum Z|Rep: Prefoldin, alpha
           subunit - Methanocorpusculum labreanum (strain ATCC
           43576 / DSM 4855 / Z), partial (12%)
          Length = 583

 Score = 91.7 bits (46), Expect = 4e-18
 Identities = 52/54 (96%)
 Strand = Plus / Plus

                                                                 
Query: 327 gattcttgatacattagctaagatggagaaacgtggggagcgctttaagcagcc 380
           |||||||||| |||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 199 gattcttgattcattagctaagatggagaaacgtggggagcgcttcaagcagcc 252



 Score = 67.9 bits (34), Expect = 6e-11
 Identities = 37/38 (97%)
 Strand = Plus / Plus

                                                 
Query: 137 ataaagggcagaaagaaagtttggatattgaggaaggt 174
           ||||||||||||||||||| ||||||||||||||||||
Sbjct: 36  ataaagggcagaaagaaagcttggatattgaggaaggt 73