Miyakogusa Predicted Gene
- Lj4g3v2265070.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2265070.1 Non Chatacterized Hit- tr|I1MRR0|I1MRR0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.34618
PE,82.81,0,Pkinase_Tyr,Serine-threonine/tyrosine-protein kinase
catalytic domain; PROTEIN_KINASE_DOM,Protein
ki,NODE_57911_length_1536_cov_72.676430.path1.1
(1158 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO012984 similar to UniRef100_A2Q2V9 Cluster: Protein k... 686 0.0
gnl|LJGI|TC61380 similar to UniRef100_Q93XL9 Cluster: CTR1-like ... 60 3e-08
gnl|LJGI|TC63662 similar to UniRef100_O23719 Cluster: MAP3K delt... 56 5e-07
>gnl|LJGI|GO012984 similar to UniRef100_A2Q2V9 Cluster: Protein kinase; n=1; Medicago
truncatula|Rep: Protein kinase - Medicago truncatula
(Barrel medic), partial (40%)
Length = 632
Score = 686 bits (346), Expect = 0.0
Identities = 349/350 (99%)
Strand = Plus / Plus
Query: 809 ggatggcgcctgaagttcttcgtaacgaaccctctgatgagaagtctgacgtttacagct 868
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 ggatggcgcctgaagttcttcgtaacgaaccctctgatgagaagtctgacgtttacagct 60
Query: 869 ttggggtgatattgtgggaacttgcgactgaaaagatcccttgggatactctcaatacaa 928
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 61 ttggggtgatattgtgggaacttgcgactgaaaagatcccttgggatactctcaacacaa 120
Query: 929 tgcaggttattggagctgttggttttatgaacaatcggctagaaattccagaagatgttg 988
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 tgcaggttattggagctgttggttttatgaacaatcggctagaaattccagaagatgttg 180
Query: 989 atccacagtgggcttctataatagagggttgctggcaaagcgatccagcttgccgaccaa 1048
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 atccacagtgggcttctataatagagggttgctggcaaagcgatccagcttgccgaccaa 240
Query: 1049 gtttccgggaactgttagataggcttagagaactgcagagacggtacgccattcagttcc 1108
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 gtttccgggaactgttagataggcttagagaactgcagagacggtacgccattcagttcc 300
Query: 1109 aggcagccagatctaatggtggggaaggcgcccaaaaggattcatagcca 1158
||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 aggcagccagatctaatggtggggaaggcgcccaaaaggattcatagcca 350
>gnl|LJGI|TC61380 similar to UniRef100_Q93XL9 Cluster: CTR1-like protein kinase; n=2;
Rosa hybrid cultivar|Rep: CTR1-like protein kinase -
Rosa hybrid cultivar, partial (14%)
Length = 1189
Score = 60.0 bits (30), Expect = 3e-08
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 808 tggatggcgcctgaagttcttcgtaacgaaccctctgatgagaagtctgacgtttacagc 867
|||||||| || |||||||||||| | || || || ||||||||||||| |||||||||
Sbjct: 38 tggatggctccagaagttcttcgtgatgagccatcgaatgagaagtctgatgtttacagc 97
Query: 868 tttggggtgatattgtgggaacttgc 893
||||| | || |||||||| |||||
Sbjct: 98 tttggtataatcttgtgggagcttgc 123
>gnl|LJGI|TC63662 similar to UniRef100_O23719 Cluster: MAP3K delta-1 protein kinase;
n=1; Arabidopsis thaliana|Rep: MAP3K delta-1 protein
kinase - Arabidopsis thaliana (Mouse-ear cress), partial
(66%)
Length = 1516
Score = 56.0 bits (28), Expect = 5e-07
Identities = 58/68 (85%)
Strand = Plus / Plus
Query: 926 caatgcaggttattggagctgttggttttatgaacaatcggctagaaattccagaagatg 985
||||||||||| ||||||||||||| || || || ||||| ||||||||||||||||
Sbjct: 869 caatgcaggttgttggagctgttggattccaaaataaacggcttgaaattccagaagatg 928
Query: 986 ttgatcca 993
| ||||||
Sbjct: 929 tggatcca 936