Miyakogusa Predicted Gene
- Lj4g3v2265060.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2265060.1 Non Chatacterized Hit- tr|A5ADU7|A5ADU7_VITVI
Putative uncharacterized protein OS=Vitis vinifera GN=,41.88,6e-18,PAS
domain,PAS domain; PAS,PAS domain; sensory_box: PAS domain S-box
protein,PAS domain; seg,NULL;
P,NODE_55088_length_1043_cov_63.962608.path1.1
(951 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS338219 similar to UniRef100_A2Q2W0 Cluster: PAS; n=1;... 101 8e-21
>gnl|LJGI|FS338219 similar to UniRef100_A2Q2W0 Cluster: PAS; n=1; Medicago
truncatula|Rep: PAS - Medicago truncatula (Barrel
medic), partial (29%)
Length = 677
Score = 101 bits (51), Expect = 8e-21
Identities = 117/139 (84%)
Strand = Plus / Plus
Query: 239 agtatctcaatatcttgcagtcaatgggtcactctgttcatatacttgatcttcaatgtc 298
||||| ||||||| |||||||||||||| || |||||||||||| | |||| | | | ||
Sbjct: 356 agtatttcaatattttgcagtcaatgggacaatctgttcatatattggatcgtaactttc 415
Query: 299 gtatcgtgtactggaaccctagtgctgagaatctgtatggttatgcagcagctgaagttc 358
|||| | |||||||||| ||||||||||||||| ||||||||||||| || |||| ||
Sbjct: 416 gtataatttactggaaccatagtgctgagaatctatatggttatgcagaagaggaagctc 475
Query: 359 ttggccatgatgggattga 377
| ||||| || ||||||||
Sbjct: 476 taggccaagaagggattga 494
Score = 65.9 bits (33), Expect = 4e-10
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 58 ggtcacgttcacctcaagcaagaaatgtccaagctcaagct 98
||||| ||| |||||||||||||||||||||||||||||||
Sbjct: 130 ggtcatgtttacctcaagcaagaaatgtccaagctcaagct 170