Miyakogusa Predicted Gene
- Lj4g3v2253790.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2253790.2 Non Chatacterized Hit- tr|G7JP09|G7JP09_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,74.39,0.00000008,seg,NULL,CUFF.50632.2
(429 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC63538 313 5e-85
gnl|LJGI|BW596332 228 2e-59
gnl|LJGI|TC66371 weakly similar to UniRef100_Q10GX1 Cluster: Ser... 72 3e-12
gnl|LJGI|TC66682 similar to UniRef100_Q2HSM8 Cluster: Proteinase... 66 2e-10
gnl|LJGI|BP034134 similar to UniRef100_Q10GX1 Cluster: Serpin fa... 56 2e-07
gnl|LJGI|BP041977 similar to UniRef100_Q2HSM8 Cluster: Proteinas... 56 2e-07
gnl|LJGI|TC63404 similar to UniRef100_Q2HSM8 Cluster: Proteinase... 56 2e-07
gnl|LJGI|TC69515 similar to UniRef100_Q0DQC3 Cluster: Os03g06107... 52 3e-06
>gnl|LJGI|TC63538
Length = 943
Score = 313 bits (158), Expect = 5e-85
Identities = 158/158 (100%)
Strand = Plus / Plus
Query: 214 ttgggaacagaataccttgtccgccctttaggcaatgctgaggaggaagaagagtccagt 273
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422 ttgggaacagaataccttgtccgccctttaggcaatgctgaggaggaagaagagtccagt 481
Query: 274 gattttgaaccggaggagaatggggaggaggaagaagaaggtgatgacgacgacgatgat 333
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 482 gattttgaaccggaggagaatggggaggaggaagaagaaggtgatgacgacgacgatgat 541
Query: 334 aaggctgaggttccaccaaagaggaagaggtcaagtaa 371
||||||||||||||||||||||||||||||||||||||
Sbjct: 542 aaggctgaggttccaccaaagaggaagaggtcaagtaa 579
Score = 137 bits (69), Expect = 6e-32
Identities = 69/69 (100%)
Strand = Plus / Plus
Query: 1 atgaaggtcacggaggaggttttggaggagcatgtggaggagaacgaggtcactggtttg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 77 atgaaggtcacggaggaggttttggaggagcatgtggaggagaacgaggtcactggtttg 136
Query: 61 aatgagggc 69
|||||||||
Sbjct: 137 aatgagggc 145
>gnl|LJGI|BW596332
Length = 519
Score = 228 bits (115), Expect = 2e-59
Identities = 115/115 (100%)
Strand = Plus / Plus
Query: 214 ttgggaacagaataccttgtccgccctttaggcaatgctgaggaggaagaagagtccagt 273
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 405 ttgggaacagaataccttgtccgccctttaggcaatgctgaggaggaagaagagtccagt 464
Query: 274 gattttgaaccggaggagaatggggaggaggaagaagaaggtgatgacgacgacg 328
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 gattttgaaccggaggagaatggggaggaggaagaagaaggtgatgacgacgacg 519
Score = 121 bits (61), Expect = 4e-27
Identities = 67/69 (97%)
Strand = Plus / Plus
Query: 1 atgaaggtcacggaggaggttttggaggagcatgtggaggagaacgaggtcactggtttg 60
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 45 atgaaggtcacggaggaggttttgaaggagcatgtggaggagaacgaggtcactggtctg 104
Query: 61 aatgagggc 69
|||||||||
Sbjct: 105 aatgagggc 113
>gnl|LJGI|TC66371 weakly similar to UniRef100_Q10GX1 Cluster: Serpin family protein,
expressed; n=1; Oryza sativa Japonica Group|Rep: Serpin
family protein, expressed - Oryza sativa subsp. japonica
(Rice), partial (22%)
Length = 1681
Score = 71.9 bits (36), Expect = 3e-12
Identities = 51/56 (91%)
Strand = Plus / Plus
Query: 316 gatgacgacgacgatgataaggctgaggttccaccaaagaggaagaggtcaagtaa 371
|||| |||||| ||| |||||||||||||||||| ||||||||||||| |||||||
Sbjct: 1353 gatggcgacgatgatcataaggctgaggttccactaaagaggaagaggacaagtaa 1408
>gnl|LJGI|TC66682 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
serpin; n=1; Medicago truncatula|Rep: Proteinase
inhibitor I4, serpin - Medicago truncatula (Barrel
medic), partial (8%)
Length = 631
Score = 65.9 bits (33), Expect = 2e-10
Identities = 65/75 (86%), Gaps = 3/75 (4%)
Strand = Plus / Plus
Query: 297 ggaggaggaagaagaaggtgatgacgacgacgatgataaggctgaggttccaccaaagag 356
|||||| ||||| |||||||||||||| || ||||||| ||||| ||||||| ||||
Sbjct: 222 ggaggatgaagatgaaggtgatgacgatga---tgataagcttgaggctccaccatagag 278
Query: 357 gaagaggtcaagtaa 371
|||||||||||||||
Sbjct: 279 gaagaggtcaagtaa 293
>gnl|LJGI|BP034134 similar to UniRef100_Q10GX1 Cluster: Serpin family protein,
expressed; n=1; Oryza sativa Japonica Group|Rep: Serpin
family protein, expressed - Oryza sativa subsp. japonica
(Rice), partial (6%)
Length = 556
Score = 56.0 bits (28), Expect = 2e-07
Identities = 58/68 (85%)
Strand = Plus / Minus
Query: 299 aggaggaagaagaaggtgatgacgacgacgatgataaggctgaggttccaccaaagagga 358
|||||||||| ||| ||||||| | || |||||||| |||||||||| |||||||||
Sbjct: 366 aggaggaagatgaacgtgatgatgttgatgatgataaccatgaggttccatcaaagagga 307
Query: 359 agaggtca 366
||||||||
Sbjct: 306 agaggtca 299
>gnl|LJGI|BP041977 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
serpin; n=1; Medicago truncatula|Rep: Proteinase
inhibitor I4, serpin - Medicago truncatula (Barrel
medic), partial (8%)
Length = 571
Score = 56.0 bits (28), Expect = 2e-07
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 328 gatgataaggctgaggttccaccaaagaggaagaggtcaagtaa 371
||||||||| ||| ||||||||||||||| ||||| ||||||||
Sbjct: 326 gatgataagcctgtggttccaccaaagagaaagagatcaagtaa 283
>gnl|LJGI|TC63404 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4, serpin;
n=1; Medicago truncatula|Rep: Proteinase inhibitor I4,
serpin - Medicago truncatula (Barrel medic), partial
(39%)
Length = 1719
Score = 56.0 bits (28), Expect = 2e-07
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 328 gatgataaggctgaggttccaccaaagaggaagaggtcaagtaa 371
||||||||| ||| ||||||||||||||| ||||| ||||||||
Sbjct: 1415 gatgataagcctgtggttccaccaaagagaaagagatcaagtaa 1458
>gnl|LJGI|TC69515 similar to UniRef100_Q0DQC3 Cluster: Os03g0610700 protein; n=2;
Oryza sativa|Rep: Os03g0610700 protein - Oryza sativa
subsp. japonica (Rice), partial (24%)
Length = 700
Score = 52.0 bits (26), Expect = 3e-06
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 328 gatgataaggctgaggttccaccaaagaggaaga 361
||||||| | ||||||||||||||||||||||||
Sbjct: 297 gatgatacgcctgaggttccaccaaagaggaaga 330