Miyakogusa Predicted Gene

Lj4g3v2253790.2
Show Alignment: 
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2253790.2 Non Chatacterized Hit- tr|G7JP09|G7JP09_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,74.39,0.00000008,seg,NULL,CUFF.50632.2
         (429 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63538                                                      313   5e-85
gnl|LJGI|BW596332                                                     228   2e-59
gnl|LJGI|TC66371 weakly similar to UniRef100_Q10GX1 Cluster: Ser...    72   3e-12
gnl|LJGI|TC66682 similar to UniRef100_Q2HSM8 Cluster: Proteinase...    66   2e-10
gnl|LJGI|BP034134 similar to UniRef100_Q10GX1 Cluster: Serpin fa...    56   2e-07
gnl|LJGI|BP041977 similar to UniRef100_Q2HSM8 Cluster: Proteinas...    56   2e-07
gnl|LJGI|TC63404 similar to UniRef100_Q2HSM8 Cluster: Proteinase...    56   2e-07
gnl|LJGI|TC69515 similar to UniRef100_Q0DQC3 Cluster: Os03g06107...    52   3e-06

>gnl|LJGI|TC63538 
          Length = 943

 Score =  313 bits (158), Expect = 5e-85
 Identities = 158/158 (100%)
 Strand = Plus / Plus

                                                                       
Query: 214 ttgggaacagaataccttgtccgccctttaggcaatgctgaggaggaagaagagtccagt 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422 ttgggaacagaataccttgtccgccctttaggcaatgctgaggaggaagaagagtccagt 481

                                                                       
Query: 274 gattttgaaccggaggagaatggggaggaggaagaagaaggtgatgacgacgacgatgat 333
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 482 gattttgaaccggaggagaatggggaggaggaagaagaaggtgatgacgacgacgatgat 541

                                                 
Query: 334 aaggctgaggttccaccaaagaggaagaggtcaagtaa 371
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 542 aaggctgaggttccaccaaagaggaagaggtcaagtaa 579



 Score =  137 bits (69), Expect = 6e-32
 Identities = 69/69 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaaggtcacggaggaggttttggaggagcatgtggaggagaacgaggtcactggtttg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 77  atgaaggtcacggaggaggttttggaggagcatgtggaggagaacgaggtcactggtttg 136

                    
Query: 61  aatgagggc 69
           |||||||||
Sbjct: 137 aatgagggc 145


>gnl|LJGI|BW596332 
          Length = 519

 Score =  228 bits (115), Expect = 2e-59
 Identities = 115/115 (100%)
 Strand = Plus / Plus

                                                                       
Query: 214 ttgggaacagaataccttgtccgccctttaggcaatgctgaggaggaagaagagtccagt 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 405 ttgggaacagaataccttgtccgccctttaggcaatgctgaggaggaagaagagtccagt 464

                                                                  
Query: 274 gattttgaaccggaggagaatggggaggaggaagaagaaggtgatgacgacgacg 328
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 465 gattttgaaccggaggagaatggggaggaggaagaagaaggtgatgacgacgacg 519



 Score =  121 bits (61), Expect = 4e-27
 Identities = 67/69 (97%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaaggtcacggaggaggttttggaggagcatgtggaggagaacgaggtcactggtttg 60
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||
Sbjct: 45  atgaaggtcacggaggaggttttgaaggagcatgtggaggagaacgaggtcactggtctg 104

                    
Query: 61  aatgagggc 69
           |||||||||
Sbjct: 105 aatgagggc 113


>gnl|LJGI|TC66371 weakly similar to UniRef100_Q10GX1 Cluster: Serpin family protein,
            expressed; n=1; Oryza sativa Japonica Group|Rep: Serpin
            family protein, expressed - Oryza sativa subsp. japonica
            (Rice), partial (22%)
          Length = 1681

 Score = 71.9 bits (36), Expect = 3e-12
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                    
Query: 316  gatgacgacgacgatgataaggctgaggttccaccaaagaggaagaggtcaagtaa 371
            |||| |||||| ||| |||||||||||||||||| ||||||||||||| |||||||
Sbjct: 1353 gatggcgacgatgatcataaggctgaggttccactaaagaggaagaggacaagtaa 1408


>gnl|LJGI|TC66682 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
           serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (8%)
          Length = 631

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 65/75 (86%), Gaps = 3/75 (4%)
 Strand = Plus / Plus

                                                                       
Query: 297 ggaggaggaagaagaaggtgatgacgacgacgatgataaggctgaggttccaccaaagag 356
           |||||| ||||| |||||||||||||| ||   |||||||  ||||| ||||||| ||||
Sbjct: 222 ggaggatgaagatgaaggtgatgacgatga---tgataagcttgaggctccaccatagag 278

                          
Query: 357 gaagaggtcaagtaa 371
           |||||||||||||||
Sbjct: 279 gaagaggtcaagtaa 293


>gnl|LJGI|BP034134 similar to UniRef100_Q10GX1 Cluster: Serpin family protein,
           expressed; n=1; Oryza sativa Japonica Group|Rep: Serpin
           family protein, expressed - Oryza sativa subsp. japonica
           (Rice), partial (6%)
          Length = 556

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 299 aggaggaagaagaaggtgatgacgacgacgatgataaggctgaggttccaccaaagagga 358
           |||||||||| ||| ||||||| |  || ||||||||   |||||||||| |||||||||
Sbjct: 366 aggaggaagatgaacgtgatgatgttgatgatgataaccatgaggttccatcaaagagga 307

                   
Query: 359 agaggtca 366
           ||||||||
Sbjct: 306 agaggtca 299


>gnl|LJGI|BP041977 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
           serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (8%)
          Length = 571

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 328 gatgataaggctgaggttccaccaaagaggaagaggtcaagtaa 371
           ||||||||| ||| ||||||||||||||| ||||| ||||||||
Sbjct: 326 gatgataagcctgtggttccaccaaagagaaagagatcaagtaa 283


>gnl|LJGI|TC63404 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4, serpin;
            n=1; Medicago truncatula|Rep: Proteinase inhibitor I4,
            serpin - Medicago truncatula (Barrel medic), partial
            (39%)
          Length = 1719

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 328  gatgataaggctgaggttccaccaaagaggaagaggtcaagtaa 371
            ||||||||| ||| ||||||||||||||| ||||| ||||||||
Sbjct: 1415 gatgataagcctgtggttccaccaaagagaaagagatcaagtaa 1458


>gnl|LJGI|TC69515 similar to UniRef100_Q0DQC3 Cluster: Os03g0610700 protein; n=2;
           Oryza sativa|Rep: Os03g0610700 protein - Oryza sativa
           subsp. japonica (Rice), partial (24%)
          Length = 700

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 328 gatgataaggctgaggttccaccaaagaggaaga 361
           ||||||| | ||||||||||||||||||||||||
Sbjct: 297 gatgatacgcctgaggttccaccaaagaggaaga 330