Miyakogusa Predicted Gene

Lj4g3v2227950.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2227950.1 Non Chatacterized Hit- tr|D8SEH4|D8SEH4_SELML
Putative uncharacterized protein PGP4A-2
OS=Selaginell,29.08,0.0000000007,no description,NULL; ABC transporter
transmembrane region,ABC transporter, transmembrane domain,
typ,NODE_84753_length_458_cov_8.746725.path2.1
         (477 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC593645 weakly similar to UniRef100_Q9FWX8 Cluster: Mu...    74   9e-13

>gnl|LJGI|DC593645 weakly similar to UniRef100_Q9FWX8 Cluster: Multidrug resistance
           protein 16; n=2; Arabidopsis thaliana|Rep: Multidrug
           resistance protein 16 - Arabidopsis thaliana (Mouse-ear
           cress), partial (8%)
          Length = 471

 Score = 73.8 bits (37), Expect = 9e-13
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 359 cttgctggatgatcactggggagagacaagctgcaagaattagaggctt 407
           |||||||||||||||| ||||||||||||||||||||||| || |||||
Sbjct: 114 cttgctggatgatcacaggggagagacaagctgcaagaataaggggctt 66