Miyakogusa Predicted Gene

Lj4g3v2227870.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2227870.1 Non Chatacterized Hit- tr|K4DHQ7|K4DHQ7_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,34.41,0.000000006,ABC transporter transmembrane region,ABC
transporter, transmembrane domain, type 1; no
description,N,CUFF.50729.1
         (357 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62656 similar to UniRef100_A7Q0Z8 Cluster: Chromosome...    72   3e-12

>gnl|LJGI|TC62656 similar to UniRef100_A7Q0Z8 Cluster: Chromosome chr7 scaffold_42,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_42, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (30%)
          Length = 1320

 Score = 71.9 bits (36), Expect = 3e-12
 Identities = 98/116 (84%), Gaps = 2/116 (1%)
 Strand = Plus / Plus

                                                                       
Query: 92  tgtatgaagatgcgagtcaagtggcaaatgatgctgttgggagtataagaactgttgctt 151
           ||||||| || || || ||||| || |||||||| |||||||| ||||||||||| || |
Sbjct: 12  tgtatgaggaagcaagccaagttgctaatgatgcagttgggagcataagaactgtagcgt 71

                                                                   
Query: 152 ctttctgtgctgaagagaaggtgatgaaattataccaggaa-agatgtgagggacc 206
           ||||||||||||| || ||||| ||| || |||| |||||| | ||||||||||||
Sbjct: 72  ctttctgtgctgaggataaggttatggaactata-caggaagaaatgtgagggacc 126