Miyakogusa Predicted Gene
- Lj4g3v2225720.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2225720.1 Non Chatacterized Hit- tr|I1LDZ3|I1LDZ3_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.8429 PE=,75.38,2e-18,no
description,Nucleic acid-binding, OB-fold; no description,NULL;
Nucleic acid-binding proteins,Nuc,CUFF.50540.1
(1215 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC70178 similar to UniRef100_P37384 Cluster: Meiotic re... 105 6e-22
gnl|LJGI|TC66069 similar to UniRef100_P37384 Cluster: Meiotic re... 105 6e-22
gnl|LJGI|TC73023 homologue to UniRef100_Q96449 Cluster: Meiotic ... 96 6e-19
gnl|LJGI|TC74283 86 6e-16
gnl|LJGI|BP051421 homologue to UniRef100_Q96449 Cluster: Meiotic... 78 1e-13
gnl|LJGI|BP034215 similar to UniRef100_Q39009 Cluster: Meiotic r... 68 1e-10
gnl|LJGI|TC57610 similar to UniRef100_Q6WG36 Cluster: RPA 70kDa ... 56 5e-07
gnl|LJGI|GO036434 similar to UniRef100_A7NW03 Cluster: Chromosom... 52 8e-06
gnl|LJGI|AV780052 52 8e-06
>gnl|LJGI|TC70178 similar to UniRef100_P37384 Cluster: Meiotic recombination protein
DMC1 homolog; n=1; Lilium longiflorum|Rep: Meiotic
recombination protein DMC1 homolog - Lilium longiflorum
(Trumpet lily), partial (23%)
Length = 1336
Score = 105 bits (53), Expect = 6e-22
Identities = 62/65 (95%)
Strand = Plus / Plus
Query: 210 tgtagattcagtgattgctttgtttagggtggacttttctggaagaggagagcttgctga 269
|||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||
Sbjct: 1070 tgtagattcaatgattgctttgtttagggtggacttttcaggaaaaggagagcttgctga 1129
Query: 270 gcgcc 274
|||||
Sbjct: 1130 gcgcc 1134
>gnl|LJGI|TC66069 similar to UniRef100_P37384 Cluster: Meiotic recombination protein
DMC1 homolog; n=1; Lilium longiflorum|Rep: Meiotic
recombination protein DMC1 homolog - Lilium longiflorum
(Trumpet lily), partial (23%)
Length = 802
Score = 105 bits (53), Expect = 6e-22
Identities = 62/65 (95%)
Strand = Plus / Plus
Query: 210 tgtagattcagtgattgctttgtttagggtggacttttctggaagaggagagcttgctga 269
|||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||
Sbjct: 478 tgtagattcaatgattgctttgtttagggtggacttttcaggaaaaggagagcttgctga 537
Query: 270 gcgcc 274
|||||
Sbjct: 538 gcgcc 542
>gnl|LJGI|TC73023 homologue to UniRef100_Q96449 Cluster: Meiotic recombination
protein DMC1 homolog; n=1; Glycine max|Rep: Meiotic
recombination protein DMC1 homolog - Glycine max
(Soybean), partial (22%)
Length = 1105
Score = 95.6 bits (48), Expect = 6e-19
Identities = 57/60 (95%)
Strand = Plus / Plus
Query: 207 gattgtagattcagtgattgctttgtttagggtggacttttctggaagaggagagcttgc 266
|||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||
Sbjct: 501 gattgtagattcagtggttgctttgtatagggtggacttttcaggaagaggagagcttgc 560
>gnl|LJGI|TC74283
Length = 560
Score = 85.7 bits (43), Expect = 6e-16
Identities = 67/75 (89%)
Strand = Plus / Plus
Query: 207 gattgtagattcagtgattgctttgtttagggtggacttttctggaagaggagagcttgc 266
|||||||||||| |||||||||||| ||||||||||||||| |||| || ||||||||
Sbjct: 8 gattgtagattctatgattgctttgtatagggtggacttttcaggaaatggggagcttgc 67
Query: 267 tgagcgccagcaaaa 281
||||||||| |||||
Sbjct: 68 tgagcgccatcaaaa 82
>gnl|LJGI|BP051421 homologue to UniRef100_Q96449 Cluster: Meiotic recombination
protein DMC1 homolog; n=1; Glycine max|Rep: Meiotic
recombination protein DMC1 homolog - Glycine max
(Soybean), partial (31%)
Length = 494
Score = 77.8 bits (39), Expect = 1e-13
Identities = 90/107 (84%)
Strand = Plus / Minus
Query: 250 ggaagaggagagcttgctgagcgccagcaaaatctgttcccaaaggtttatccattagtg 309
|||||||||||||| ||||||||||||||||| ||| | || | ||| || ||| |
Sbjct: 489 ggaagaggagagctcgctgagcgccagcaaaaactggcacaaatgctttctcgattgata 430
Query: 310 aagatatgtgtgaaattcaatgttgcagtttacatgacaaatcaagt 356
|||||| || | ||||||||||||||||||||||||||||||||||
Sbjct: 429 aagatagctgaggaattcaatgttgcagtttacatgacaaatcaagt 383
>gnl|LJGI|BP034215 similar to UniRef100_Q39009 Cluster: Meiotic recombination protein
DMC1 homolog; n=1; Arabidopsis thaliana|Rep: Meiotic
recombination protein DMC1 homolog - Arabidopsis
thaliana (Mouse-ear cress), partial (8%)
Length = 502
Score = 67.9 bits (34), Expect = 1e-10
Identities = 46/50 (92%)
Strand = Plus / Minus
Query: 217 tcagtgattgctttgtttagggtggacttttctggaagaggagagcttgc 266
|||||| ||||||||| ||||||||||||||| | |||||||||||||||
Sbjct: 502 tcagtggttgctttgtatagggtggacttttcggtaagaggagagcttgc 453
Score = 52.0 bits (26), Expect = 8e-06
Identities = 29/30 (96%)
Strand = Plus / Minus
Query: 323 aattcaatgttgcagtttacatgacaaatc 352
||||||||||||||||||||||||| ||||
Sbjct: 398 aattcaatgttgcagtttacatgaccaatc 369
>gnl|LJGI|TC57610 similar to UniRef100_Q6WG36 Cluster: RPA 70kDa subunit; n=1; Pisum
sativum|Rep: RPA 70kDa subunit - Pisum sativum (Garden
pea), partial (35%)
Length = 937
Score = 56.0 bits (28), Expect = 5e-07
Identities = 67/80 (83%)
Strand = Plus / Plus
Query: 52 ggttccgtcgttcaactgatcgagtatatttgcagtcctattcagaatcgcaagataatc 111
|||||||||||||| || ||||| ||||| ||| | || | |||||||||||||| ||
Sbjct: 379 ggttccgtcgttcagcttatcgattatatatgctctactctccagaatcgcaagattatt 438
Query: 112 gtggcgctcaacatggaaac 131
|||| ||| |||||||||||
Sbjct: 439 gtggtgcttaacatggaaac 458
>gnl|LJGI|GO036434 similar to UniRef100_A7NW03 Cluster: Chromosome chr5 scaffold_2,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr5 scaffold_2, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (9%)
Length = 600
Score = 52.0 bits (26), Expect = 8e-06
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 323 aattcaatgttgcagtttacatgacaaatcaagt 356
||||||||||||||| |||||| |||||||||||
Sbjct: 306 aattcaatgttgcagcttacatcacaaatcaagt 339
>gnl|LJGI|AV780052
Length = 584
Score = 52.0 bits (26), Expect = 8e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 237 ggtggacttttctggaagaggagagcttgc 266
|||||||||||| |||||||||||||||||
Sbjct: 527 ggtggacttttcaggaagaggagagcttgc 556