Miyakogusa Predicted Gene

Lj4g3v2225720.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2225720.1 Non Chatacterized Hit- tr|I1LDZ3|I1LDZ3_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.8429 PE=,75.38,2e-18,no
description,Nucleic acid-binding, OB-fold; no description,NULL;
Nucleic acid-binding proteins,Nuc,CUFF.50540.1
         (1215 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70178 similar to UniRef100_P37384 Cluster: Meiotic re...   105   6e-22
gnl|LJGI|TC66069 similar to UniRef100_P37384 Cluster: Meiotic re...   105   6e-22
gnl|LJGI|TC73023 homologue to UniRef100_Q96449 Cluster: Meiotic ...    96   6e-19
gnl|LJGI|TC74283                                                       86   6e-16
gnl|LJGI|BP051421 homologue to UniRef100_Q96449 Cluster: Meiotic...    78   1e-13
gnl|LJGI|BP034215 similar to UniRef100_Q39009 Cluster: Meiotic r...    68   1e-10
gnl|LJGI|TC57610 similar to UniRef100_Q6WG36 Cluster: RPA 70kDa ...    56   5e-07
gnl|LJGI|GO036434 similar to UniRef100_A7NW03 Cluster: Chromosom...    52   8e-06
gnl|LJGI|AV780052                                                      52   8e-06

>gnl|LJGI|TC70178 similar to UniRef100_P37384 Cluster: Meiotic recombination protein
            DMC1 homolog; n=1; Lilium longiflorum|Rep: Meiotic
            recombination protein DMC1 homolog - Lilium longiflorum
            (Trumpet lily), partial (23%)
          Length = 1336

 Score =  105 bits (53), Expect = 6e-22
 Identities = 62/65 (95%)
 Strand = Plus / Plus

                                                                        
Query: 210  tgtagattcagtgattgctttgtttagggtggacttttctggaagaggagagcttgctga 269
            |||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||
Sbjct: 1070 tgtagattcaatgattgctttgtttagggtggacttttcaggaaaaggagagcttgctga 1129

                 
Query: 270  gcgcc 274
            |||||
Sbjct: 1130 gcgcc 1134


>gnl|LJGI|TC66069 similar to UniRef100_P37384 Cluster: Meiotic recombination protein
           DMC1 homolog; n=1; Lilium longiflorum|Rep: Meiotic
           recombination protein DMC1 homolog - Lilium longiflorum
           (Trumpet lily), partial (23%)
          Length = 802

 Score =  105 bits (53), Expect = 6e-22
 Identities = 62/65 (95%)
 Strand = Plus / Plus

                                                                       
Query: 210 tgtagattcagtgattgctttgtttagggtggacttttctggaagaggagagcttgctga 269
           |||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||
Sbjct: 478 tgtagattcaatgattgctttgtttagggtggacttttcaggaaaaggagagcttgctga 537

                
Query: 270 gcgcc 274
           |||||
Sbjct: 538 gcgcc 542


>gnl|LJGI|TC73023 homologue to UniRef100_Q96449 Cluster: Meiotic recombination
           protein DMC1 homolog; n=1; Glycine max|Rep: Meiotic
           recombination protein DMC1 homolog - Glycine max
           (Soybean), partial (22%)
          Length = 1105

 Score = 95.6 bits (48), Expect = 6e-19
 Identities = 57/60 (95%)
 Strand = Plus / Plus

                                                                       
Query: 207 gattgtagattcagtgattgctttgtttagggtggacttttctggaagaggagagcttgc 266
           |||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||
Sbjct: 501 gattgtagattcagtggttgctttgtatagggtggacttttcaggaagaggagagcttgc 560


>gnl|LJGI|TC74283 
          Length = 560

 Score = 85.7 bits (43), Expect = 6e-16
 Identities = 67/75 (89%)
 Strand = Plus / Plus

                                                                       
Query: 207 gattgtagattcagtgattgctttgtttagggtggacttttctggaagaggagagcttgc 266
           ||||||||||||  |||||||||||| ||||||||||||||| ||||  || ||||||||
Sbjct: 8   gattgtagattctatgattgctttgtatagggtggacttttcaggaaatggggagcttgc 67

                          
Query: 267 tgagcgccagcaaaa 281
           ||||||||| |||||
Sbjct: 68  tgagcgccatcaaaa 82


>gnl|LJGI|BP051421 homologue to UniRef100_Q96449 Cluster: Meiotic recombination
           protein DMC1 homolog; n=1; Glycine max|Rep: Meiotic
           recombination protein DMC1 homolog - Glycine max
           (Soybean), partial (31%)
          Length = 494

 Score = 77.8 bits (39), Expect = 1e-13
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 ggaagaggagagcttgctgagcgccagcaaaatctgttcccaaaggtttatccattagtg 309
           |||||||||||||| ||||||||||||||||| |||   | || | ||| || |||  | 
Sbjct: 489 ggaagaggagagctcgctgagcgccagcaaaaactggcacaaatgctttctcgattgata 430

                                                          
Query: 310 aagatatgtgtgaaattcaatgttgcagtttacatgacaaatcaagt 356
           ||||||  || | ||||||||||||||||||||||||||||||||||
Sbjct: 429 aagatagctgaggaattcaatgttgcagtttacatgacaaatcaagt 383


>gnl|LJGI|BP034215 similar to UniRef100_Q39009 Cluster: Meiotic recombination protein
           DMC1 homolog; n=1; Arabidopsis thaliana|Rep: Meiotic
           recombination protein DMC1 homolog - Arabidopsis
           thaliana (Mouse-ear cress), partial (8%)
          Length = 502

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 217 tcagtgattgctttgtttagggtggacttttctggaagaggagagcttgc 266
           |||||| ||||||||| ||||||||||||||| | |||||||||||||||
Sbjct: 502 tcagtggttgctttgtatagggtggacttttcggtaagaggagagcttgc 453



 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 323 aattcaatgttgcagtttacatgacaaatc 352
           ||||||||||||||||||||||||| ||||
Sbjct: 398 aattcaatgttgcagtttacatgaccaatc 369


>gnl|LJGI|TC57610 similar to UniRef100_Q6WG36 Cluster: RPA 70kDa subunit; n=1; Pisum
           sativum|Rep: RPA 70kDa subunit - Pisum sativum (Garden
           pea), partial (35%)
          Length = 937

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 52  ggttccgtcgttcaactgatcgagtatatttgcagtcctattcagaatcgcaagataatc 111
           |||||||||||||| || ||||| ||||| |||  | || | |||||||||||||| || 
Sbjct: 379 ggttccgtcgttcagcttatcgattatatatgctctactctccagaatcgcaagattatt 438

                               
Query: 112 gtggcgctcaacatggaaac 131
           |||| ||| |||||||||||
Sbjct: 439 gtggtgcttaacatggaaac 458


>gnl|LJGI|GO036434 similar to UniRef100_A7NW03 Cluster: Chromosome chr5 scaffold_2,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_2, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (9%)
          Length = 600

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 323 aattcaatgttgcagtttacatgacaaatcaagt 356
           ||||||||||||||| |||||| |||||||||||
Sbjct: 306 aattcaatgttgcagcttacatcacaaatcaagt 339


>gnl|LJGI|AV780052 
          Length = 584

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 237 ggtggacttttctggaagaggagagcttgc 266
           |||||||||||| |||||||||||||||||
Sbjct: 527 ggtggacttttcaggaagaggagagcttgc 556