Miyakogusa Predicted Gene
- Lj4g3v2215070.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2215070.2 Non Chatacterized Hit- tr|C5YCA6|C5YCA6_SORBI
Putative uncharacterized protein Sb06g001800
OS=Sorghu,45.36,4e-19,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
seg,NULL; Auxin_inducible,Auxin responsive SAUR pro,CUFF.50486.2
(498 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP037843 homologue to UniRef100_Q8H6T6 Cluster: Auxin-r... 311 2e-84
gnl|LJGI|TC69164 similar to UniRef100_Q8H6T6 Cluster: Auxin-regu... 157 8e-38
>gnl|LJGI|BP037843 homologue to UniRef100_Q8H6T6 Cluster: Auxin-regulated protein;
n=1; Phaseolus vulgaris|Rep: Auxin-regulated protein -
Phaseolus vulgaris (Kidney bean) (French bean), partial
(21%)
Length = 428
Score = 311 bits (157), Expect = 2e-84
Identities = 157/157 (100%)
Strand = Plus / Minus
Query: 342 aaaggctgctgaggaatttgggtttgaccacagtggtgcactcaccattccatgtgaaat 401
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 428 aaaggctgctgaggaatttgggtttgaccacagtggtgcactcaccattccatgtgaaat 369
Query: 402 tgagacttttaagtacctcctcaactgcatggagaacacccatcagcaacatgatgacag 461
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 368 tgagacttttaagtacctcctcaactgcatggagaacacccatcagcaacatgatgacag 309
Query: 462 cccctctgacaacacaggaacaattgaagagtaaata 498
|||||||||||||||||||||||||||||||||||||
Sbjct: 308 cccctctgacaacacaggaacaattgaagagtaaata 272
>gnl|LJGI|TC69164 similar to UniRef100_Q8H6T6 Cluster: Auxin-regulated protein; n=1;
Phaseolus vulgaris|Rep: Auxin-regulated protein -
Phaseolus vulgaris (Kidney bean) (French bean), partial
(69%)
Length = 768
Score = 157 bits (79), Expect = 8e-38
Identities = 148/171 (86%)
Strand = Plus / Plus
Query: 238 gatgttcccaaagggtacttagccgtctatgtcggtccggagcttcggaggttcatcatt 297
|||||||| ||||| || || || || ||||| || ||||||||||||||||||||||||
Sbjct: 582 gatgttccgaaaggctatttggcagtgtatgttggaccggagcttcggaggttcatcatt 641
Query: 298 cccaccagctaccttacccaccctctcttcaaaatgttgctggaaaaggctgctgaggaa 357
||||||||||| ||||| ||| ||||||||||| |||| |||||||| |||||||| |||
Sbjct: 642 cccaccagctatcttacacactctctcttcaaagtgttactggaaaaagctgctgatgaa 701
Query: 358 tttgggtttgaccacagtggtgcactcaccattccatgtgaaattgagact 408
|| ||||||||||| ||||||| ||||| || || ||||| |||||||||
Sbjct: 702 ttcgggtttgaccagagtggtgggctcactatcccttgtgagattgagact 752