Miyakogusa Predicted Gene

Lj4g3v2215070.2
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2215070.2 Non Chatacterized Hit- tr|C5YCA6|C5YCA6_SORBI
Putative uncharacterized protein Sb06g001800
OS=Sorghu,45.36,4e-19,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
seg,NULL; Auxin_inducible,Auxin responsive SAUR pro,CUFF.50486.2
         (498 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP037843 homologue to UniRef100_Q8H6T6 Cluster: Auxin-r...   311   2e-84
gnl|LJGI|TC69164 similar to UniRef100_Q8H6T6 Cluster: Auxin-regu...   157   8e-38

>gnl|LJGI|BP037843 homologue to UniRef100_Q8H6T6 Cluster: Auxin-regulated protein;
           n=1; Phaseolus vulgaris|Rep: Auxin-regulated protein -
           Phaseolus vulgaris (Kidney bean) (French bean), partial
           (21%)
          Length = 428

 Score =  311 bits (157), Expect = 2e-84
 Identities = 157/157 (100%)
 Strand = Plus / Minus

                                                                       
Query: 342 aaaggctgctgaggaatttgggtttgaccacagtggtgcactcaccattccatgtgaaat 401
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 428 aaaggctgctgaggaatttgggtttgaccacagtggtgcactcaccattccatgtgaaat 369

                                                                       
Query: 402 tgagacttttaagtacctcctcaactgcatggagaacacccatcagcaacatgatgacag 461
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 368 tgagacttttaagtacctcctcaactgcatggagaacacccatcagcaacatgatgacag 309

                                                
Query: 462 cccctctgacaacacaggaacaattgaagagtaaata 498
           |||||||||||||||||||||||||||||||||||||
Sbjct: 308 cccctctgacaacacaggaacaattgaagagtaaata 272


>gnl|LJGI|TC69164 similar to UniRef100_Q8H6T6 Cluster: Auxin-regulated protein; n=1;
           Phaseolus vulgaris|Rep: Auxin-regulated protein -
           Phaseolus vulgaris (Kidney bean) (French bean), partial
           (69%)
          Length = 768

 Score =  157 bits (79), Expect = 8e-38
 Identities = 148/171 (86%)
 Strand = Plus / Plus

                                                                       
Query: 238 gatgttcccaaagggtacttagccgtctatgtcggtccggagcttcggaggttcatcatt 297
           |||||||| ||||| || || || || ||||| || ||||||||||||||||||||||||
Sbjct: 582 gatgttccgaaaggctatttggcagtgtatgttggaccggagcttcggaggttcatcatt 641

                                                                       
Query: 298 cccaccagctaccttacccaccctctcttcaaaatgttgctggaaaaggctgctgaggaa 357
           ||||||||||| ||||| ||| ||||||||||| |||| |||||||| |||||||| |||
Sbjct: 642 cccaccagctatcttacacactctctcttcaaagtgttactggaaaaagctgctgatgaa 701

                                                              
Query: 358 tttgggtttgaccacagtggtgcactcaccattccatgtgaaattgagact 408
           || ||||||||||| |||||||  ||||| || || ||||| |||||||||
Sbjct: 702 ttcgggtttgaccagagtggtgggctcactatcccttgtgagattgagact 752