Miyakogusa Predicted Gene

Lj4g3v2214670.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2214670.1 tr|I1LY82|I1LY82_SOYBN Beta-galactosidase
OS=Glycine max PE=3 SV=1,71.22,0,seg,NULL; Glyco_hydro_35,Glycoside
hydrolase, family 35; Gal_Lectin,D-galactoside/L-rhamnose
binding,gene.g56381.t1.1
         (2175 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81816 homologue to UniRef100_O65761 Cluster: Beta-gal...    76   1e-12
gnl|LJGI|TC65876 similar to UniRef100_Q5CCP8 Cluster: Beta-galac...    60   6e-08

>gnl|LJGI|TC81816 homologue to UniRef100_O65761 Cluster: Beta-galactosidase; n=1;
           Cicer arietinum|Rep: Beta-galactosidase - Cicer
           arietinum (Chickpea) (Garbanzo), partial (67%)
          Length = 1431

 Score = 75.8 bits (38), Expect = 1e-12
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 868 aattattatatgtatcatggggggactaattttggaagaacagctggtggtccatacatt 927
           |||||||| |||||||||||||| || |||||||| ||||| |||||||| || |  |||
Sbjct: 9   aattattacatgtatcatgggggaacaaattttggtagaactgctggtggaccctttatt 68

                                                 
Query: 928 accacatcatatgattatgatgctcctcttgatgaata 965
            ||||    |||||||||||||| ||||||||||||||
Sbjct: 69  gccacgagctatgattatgatgcacctcttgatgaata 106


>gnl|LJGI|TC65876 similar to UniRef100_Q5CCP8 Cluster: Beta-galactosidase; n=1; Pyrus
           pyrifolia|Rep: Beta-galactosidase - Pyrus pyrifolia
           (Japanese pear) (Pyrus serotina), partial (25%)
          Length = 890

 Score = 60.0 bits (30), Expect = 6e-08
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 339 tcttcgcattggtccctatgtttgtgctgaatggaattatggagggattcctgt 392
           |||||||||||| || ||||| |||||||||||||||| ||||||  |||||||
Sbjct: 507 tcttcgcattggaccttatgtctgtgctgaatggaattttggaggatttcctgt 560