Miyakogusa Predicted Gene

Lj4g3v2179270.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2179270.1 CUFF.50427.1
         (2010 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW620732 similar to UniRef100_Q6XSH3 Cluster: Lecithine...   194   1e-48
gnl|LJGI|TC62644 similar to UniRef100_Q6XSH3 Cluster: Lecithine ...   194   1e-48
gnl|LJGI|AV419792 homologue to UniRef100_Q6XSH3 Cluster: Lecithi...    78   2e-13
gnl|LJGI|TC70188 homologue to UniRef100_Q6XSH3 Cluster: Lecithin...    74   4e-12

>gnl|LJGI|BW620732 similar to UniRef100_Q6XSH3 Cluster: Lecithine cholesterol
           acyltransferase-like protein; n=1; Medicago
           truncatula|Rep: Lecithine cholesterol
           acyltransferase-like protein - Medicago truncatula
           (Barrel medic), partial (5%)
          Length = 474

 Score =  194 bits (98), Expect = 1e-48
 Identities = 98/98 (100%)
 Strand = Plus / Plus

                                                                       
Query: 132 atggtcgtgtgttgatagctgttgttggtttgtaggattcatatgctcggtttggtggtt 191
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 377 atggtcgtgtgttgatagctgttgttggtttgtaggattcatatgctcggtttggtggtt 436

                                                 
Query: 192 cttgctgtttttgtacaatgcaatgccggcgtcgtttc 229
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 437 cttgctgtttttgtacaatgcaatgccggcgtcgtttc 474



 Score =  101 bits (51), Expect = 2e-20
 Identities = 51/51 (100%)
 Strand = Plus / Plus

                                                              
Query: 1   atgtcgtttctacggcgtagaaaggccgttgtgaatcccattccagatcat 51
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 240 atgtcgtttctacggcgtagaaaggccgttgtgaatcccattccagatcat 290


>gnl|LJGI|TC62644 similar to UniRef100_Q6XSH3 Cluster: Lecithine cholesterol
           acyltransferase-like protein; n=1; Medicago
           truncatula|Rep: Lecithine cholesterol
           acyltransferase-like protein - Medicago truncatula
           (Barrel medic), partial (20%)
          Length = 890

 Score =  194 bits (98), Expect = 1e-48
 Identities = 242/290 (83%)
 Strand = Plus / Plus

                                                                       
Query: 133 tggtcgtgtgttgatagctgttgttggtttgtaggattcatatgctcggtttggtggttc 192
           ||||||||| |||||| |||||| |||||||| || | ||| ||| |||| |||||||| 
Sbjct: 552 tggtcgtgtattgataactgttgctggtttgtggggtgcatttgcacggtgtggtggttt 611

                                                                       
Query: 193 ttgctgtttttgtacaatgcaatgccggcgtcgtttcctcagtacgtgacggaggcgatt 252
           ||||||||| |||| ||    ||||| || |||||||||||||| ||||| |||||||||
Sbjct: 612 ttgctgtttctgtataagatgatgcctgcttcgtttcctcagtatgtgacagaggcgatt 671

                                                                       
Query: 253 acggggccgttgccggatcctcccggcgttaaattgaagaaggaggggttgtcggtgaac 312
           ||||||||  ||||||| || || ||| ||||| | |||||||||||| |  | ||||| 
Sbjct: 672 acggggcctatgccggacccgccgggccttaaacttaagaaggaggggctcactgtgaag 731

                                                                       
Query: 313 cacccggtggtttttgtgcctggtattgtcaccggtgggttggaactatgggagggtcgt 372
           || |||||||||||||||||||| ||||| || |||||| | ||  |||||||||||| |
Sbjct: 732 catccggtggtttttgtgcctgggattgtgactggtgggcttgagttatgggagggtcat 791

                                                             
Query: 373 cagtgtgcggatggactgttcaggaagaggttgtggggtggtacctttgg 422
           |||||||| || ||| ||||||| ||| | ||||||||||||||||||||
Sbjct: 792 cagtgtgcagagggattgttcagaaagcgcttgtggggtggtacctttgg 841


>gnl|LJGI|AV419792 homologue to UniRef100_Q6XSH3 Cluster: Lecithine cholesterol
            acyltransferase-like protein; n=1; Medicago
            truncatula|Rep: Lecithine cholesterol
            acyltransferase-like protein - Medicago truncatula
            (Barrel medic), partial (13%)
          Length = 265

 Score = 77.8 bits (39), Expect = 2e-13
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1440 tgctcatttttcccatgggattgctgataatctggatgatccaaaatacgaacattacaa 1499
            ||||||||||||  ||||  | ||||| ||| |||||||||| ||||| ||||| |||||
Sbjct: 55   tgctcatttttcttatggcgtagctgacaatttggatgatcctaaatatgaacactacaa 114

                                                               
Query: 1500 atattggtctaaccctttagaaacaacattgccaaatgctcctgatatgga 1550
            ||||||||| || || || ||  |||  |||||||||||||||||||||||
Sbjct: 115  atattggtcgaatcccttggagtcaaagttgccaaatgctcctgatatgga 165


>gnl|LJGI|TC70188 homologue to UniRef100_Q6XSH3 Cluster: Lecithine cholesterol
            acyltransferase-like protein; n=1; Medicago
            truncatula|Rep: Lecithine cholesterol
            acyltransferase-like protein - Medicago truncatula
            (Barrel medic), partial (13%)
          Length = 693

 Score = 73.8 bits (37), Expect = 4e-12
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1850 ggggaacacagagtggtgctcatgttgatatactggggaactttgcattaattgaagatg 1909
            |||| ||||| ||||||||||||||||||||  |||| ||||||||||| ||||| ||||
Sbjct: 115  ggggtacacaaagtggtgctcatgttgatattatgggaaactttgcattgattgaggatg 174

                 
Query: 1910 ttata 1914
            |||||
Sbjct: 175  ttata 179