Miyakogusa Predicted Gene

Lj4g3v2140280.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2140280.1 tr|B9I4Z4|B9I4Z4_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_772304 PE=4
SV=1,50,0.000000000001,seg,NULL,CUFF.50365.1
         (420 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72728                                                       86   2e-16
gnl|LJGI|TC58141 weakly similar to UniRef100_A0M328 Cluster: Pep...    86   2e-16

>gnl|LJGI|TC72728 
          Length = 779

 Score = 85.7 bits (43), Expect = 2e-16
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                              
Query: 200 tctggtggagatggatttctagactcatctccatttacttgttatctctca 250
           |||||||||||||| |||||||||| |||||||||||||||||||||||||
Sbjct: 443 tctggtggagatggctttctagacttatctccatttacttgttatctctca 493


>gnl|LJGI|TC58141 weakly similar to UniRef100_A0M328 Cluster: Peptidase, family M12A;
           n=1; Gramella forsetii KT0803|Rep: Peptidase, family
           M12A - Gramella forsetii (strain KT0803), partial (6%)
          Length = 960

 Score = 85.7 bits (43), Expect = 2e-16
 Identities = 49/51 (96%)
 Strand = Plus / Plus

                                                              
Query: 200 tctggtggagatggatttctagactcatctccatttacttgttatctctca 250
           |||||||||||||| |||||||||| |||||||||||||||||||||||||
Sbjct: 445 tctggtggagatggctttctagacttatctccatttacttgttatctctca 495