Miyakogusa Predicted Gene

Lj4g3v2140270.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2140270.1 Non Chatacterized Hit- tr|F6GXE9|F6GXE9_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,55.81,0.000000009,seg,NULL; no description,Concanavalin A-like
lectin/glucanase, subgroup; FAMILY NOT NAMED,NULL; Conc,CUFF.50364.1
         (305 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC60438 similar to UniRef100_Q8GTJ0 Cluster: Xyloglucan...   605   e-173
gnl|LJGI|BP033175 similar to UniRef100_A2TEI6 Cluster: Xylogluca...   389   e-108
gnl|LJGI|TC64074 similar to UniRef100_A2TEI6 Cluster: Xyloglucan...   107   4e-23
gnl|LJGI|BP030390 similar to UniRef100_A7Q6H8 Cluster: Chromosom...   100   1e-20
gnl|LJGI|TC71739 similar to UniRef100_A7Q6H8 Cluster: Chromosome...    92   2e-18
gnl|LJGI|TC60380 similar to UniRef100_A7Q6H5 Cluster: Chromosome...    78   3e-14
gnl|LJGI|TC61747 homologue to UniRef100_Q8S902 Cluster: Syringol...    66   1e-10
gnl|LJGI|TC81330 similar to UniRef100_Q2HRU5 Cluster: Glycoside ...    62   2e-09
gnl|LJGI|TC58683 homologue to UniRef100_Q2HRU6 Cluster: Glycosid...    62   2e-09
gnl|LJGI|TC68470 similar to UniRef100_P35694 Cluster: Brassinost...    58   3e-08
gnl|LJGI|TC59953 similar to UniRef100_P35694 Cluster: Brassinost...    58   3e-08
gnl|LJGI|TC69336 similar to UniRef100_A1YZ21 Cluster: Xyloglucan...    56   1e-07
gnl|LJGI|TC62499 similar to UniRef100_A7Q6H5 Cluster: Chromosome...    50   8e-06

>gnl|LJGI|TC60438 similar to UniRef100_Q8GTJ0 Cluster: Xyloglucan
           endotransglycosylase; n=1; Malus x domestica|Rep:
           Xyloglucan endotransglycosylase - Malus domestica
           (Apple) (Malus sylvestris), partial (90%)
          Length = 1166

 Score =  605 bits (305), Expect = e-173
 Identities = 305/305 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaggatattttctagcctttggaatgctgatgattgggccacaaggggaggtttggtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 602 atgaggatattttctagcctttggaatgctgatgattgggccacaaggggaggtttggtg 661

                                                                       
Query: 61  aagacagattggagtcaagccccattcactgcctcatataaaagtttcaatgcccaagct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 662 aagacagattggagtcaagccccattcactgcctcatataaaagtttcaatgcccaagct 721

                                                                       
Query: 121 tgtgtttggacttcttctggctcatcttgctcttccaaccaagattcatggatgaaagag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 722 tgtgtttggacttcttctggctcatcttgctcttccaaccaagattcatggatgaaagag 781

                                                                       
Query: 181 tcacttgattcaacagggcaagctaggattcaatgggtgcagaagaactacatgatttat 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 782 tcacttgattcaacagggcaagctaggattcaatgggtgcagaagaactacatgatttat 841

                                                                       
Query: 241 aactactgcactgatactaagcgcttcccacaaggcttccctcctgaatgctcaattgca 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 842 aactactgcactgatactaagcgcttcccacaaggcttccctcctgaatgctcaattgca 901

                
Query: 301 tgaaa 305
           |||||
Sbjct: 902 tgaaa 906


>gnl|LJGI|BP033175 similar to UniRef100_A2TEI6 Cluster: Xyloglucan
           endotransglycosylase/hydrolase XTH-6; n=1; Populus
           tremula|Rep: Xyloglucan endotransglycosylase/hydrolase
           XTH-6 - Populus tremula (European aspen), partial (22%)
          Length = 462

 Score =  389 bits (196), Expect = e-108
 Identities = 205/207 (99%), Gaps = 1/207 (0%)
 Strand = Plus / Minus

                                                                       
Query: 94  tcatataaaagtttcaatgcccaagcttgtgtttggacttcttctggctcatcttgctct 153
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 462 tcatataaaagtttcaatgcccaagcttgtgtttggacttcttctggctcatcttgctct 403

                                                                       
Query: 154 tccaaccaagattcatggatgaaagagtcacttgattcaacagggcaagctaggattcaa 213
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 402 tccaaccnagattcatggatgaaagagtcacttgattcaacagggcaagctaggattcaa 343

                                                                       
Query: 214 tgggtgcagaagaactacatgatttataactactgcactgatactaagcgcttcccacaa 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342 tgggtgcagaagaactacatgatttataactactgcactgatactaagcgcttcccacaa 283

                                      
Query: 274 ggcttccctc-ctgaatgctcaattgc 299
           |||||||||| ||||||||||||||||
Sbjct: 282 ggcttccctcnctgaatgctcaattgc 256


>gnl|LJGI|TC64074 similar to UniRef100_A2TEI6 Cluster: Xyloglucan
           endotransglycosylase/hydrolase XTH-6; n=1; Populus
           tremula|Rep: Xyloglucan endotransglycosylase/hydrolase
           XTH-6 - Populus tremula (European aspen), partial (93%)
          Length = 1164

 Score =  107 bits (54), Expect = 4e-23
 Identities = 108/126 (85%)
 Strand = Plus / Plus

                                                                       
Query: 13  tctagcctttggaatgctgatgattgggccacaaggggaggtttggtgaagacagattgg 72
           |||||||| ||||| |||||||||||||||||| |||| ||  | |||||||| ||||||
Sbjct: 605 tctagcctatggaacgctgatgattgggccacacggggtgggcttgtgaagacggattgg 664

                                                                       
Query: 73  agtcaagccccattcactgcctcatataaaagtttcaatgcccaagcttgtgtttggact 132
           |  ||||| |||||||| |||||||| | ||  |||||||| |||||||||||||||| |
Sbjct: 665 acccaagctccattcacggcctcatacagaaacttcaatgctcaagcttgtgtttggagt 724

                 
Query: 133 tcttct 138
           ||||||
Sbjct: 725 tcttct 730



 Score = 83.8 bits (42), Expect = 6e-16
 Identities = 114/138 (82%)
 Strand = Plus / Plus

                                                                       
Query: 166 tcatggatgaaagagtcacttgattcaacagggcaagctaggattcaatgggtgcagaag 225
           |||||| ||| |||||| || ||| |||  |||||||| | |||||  |||| ||| || 
Sbjct: 797 tcatggctgagagagtcgctggatgcaaacgggcaagccaagattcgctgggcgcaaaaa 856

                                                                       
Query: 226 aactacatgatttataactactgcactgatactaagcgcttcccacaaggcttccctcct 285
           |||||||||||||| ||||||||||| |||||||| || ||||||||||| |  ||||||
Sbjct: 857 aactacatgatttacaactactgcaccgatactaaacgtttcccacaaggatctcctcct 916

                             
Query: 286 gaatgctcaattgcatga 303
           || |||||  ||||||||
Sbjct: 917 gagtgctcttttgcatga 934


>gnl|LJGI|BP030390 similar to UniRef100_A7Q6H8 Cluster: Chromosome chr11 scaffold_56,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr11 scaffold_56, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (45%)
          Length = 508

 Score = 99.6 bits (50), Expect = 1e-20
 Identities = 107/126 (84%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgaggatattttctagcctttggaatgctgatgattgggccacaaggggaggtttggtg 60
           ||||||||||  || ||| | |||||||||||||| ||||| ||||| || ||| | |||
Sbjct: 416 atgaggatatactcaagcttgtggaatgctgatgactgggcaacaagaggtggtgttgtg 357

                                                                       
Query: 61  aagacagattggagtcaagccccattcactgcctcatataaaagtttcaatgcccaagct 120
           |||||||||||||| ||||| || |||||||| ||||||| || |||||||||| | |||
Sbjct: 356 aagacagattggagccaagctcctttcactgcatcatatagaaatttcaatgccaatgct 297

                 
Query: 121 tgtgtt 126
           ||||||
Sbjct: 296 tgtgtt 291


>gnl|LJGI|TC71739 similar to UniRef100_A7Q6H8 Cluster: Chromosome chr11 scaffold_56,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr11 scaffold_56, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (95%)
          Length = 1096

 Score = 91.7 bits (46), Expect = 2e-18
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaggatattttctagcctttggaatgctgatgattgggccacaaggggaggtttggtg 60
           ||||||||||  || || || |||||||||||||| ||||| ||||| || ||| | |||
Sbjct: 649 atgaggatatactcgagtctctggaatgctgatgactgggcaacaagaggtggtgttgtg 708

                                                                 
Query: 61  aagacagattggagtcaagccccattcactgcctcatataaaagtttcaatgcc 114
           |||||||||||||| ||||| || |||||||| ||||||| || ||||||||||
Sbjct: 709 aagacagattggagccaagctcctttcactgcatcatatagaaatttcaatgcc 762


>gnl|LJGI|TC60380 similar to UniRef100_A7Q6H5 Cluster: Chromosome chr11 scaffold_56,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr11 scaffold_56, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (89%)
          Length = 1106

 Score = 77.8 bits (39), Expect = 3e-14
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                       
Query: 16  agcctttggaatgctgatgattgggccacaaggggaggtttggtgaagacagattggagt 75
           ||||| ||||||||||||||||||||||||||||| ||  | || ||||||||||||  |
Sbjct: 628 agcctgtggaatgctgatgattgggccacaaggggtggactagtcaagacagattggtct 687

                                                  
Query: 76  caagccccattcactgcctcatataaaagtttcaatgcc 114
            | || |||||||| || ||||||| || ||||||||||
Sbjct: 688 aaggctccattcaccgcatcatatagaaatttcaatgcc 726


>gnl|LJGI|TC61747 homologue to UniRef100_Q8S902 Cluster: Syringolide-induced protein
           19-1-5; n=1; Glycine max|Rep: Syringolide-induced
           protein 19-1-5 - Glycine max (Soybean), partial (88%)
          Length = 1148

 Score = 65.9 bits (33), Expect = 1e-10
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaggatattttctagcctttggaatgctgatgattgggccacaaggggaggtttggtg 60
           ||||||||||  || ||||| |||||||||||||||||||| || ||||||||  | || 
Sbjct: 680 atgaggatatactccagcctctggaatgctgatgattgggcaacgaggggagggcttgtt 739

                                        
Query: 61  aagacagattggagtcaagccccattcac 89
           || ||||||||||  ||||| ||||||||
Sbjct: 740 aaaacagattggaaccaagctccattcac 768



 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 212 aatgggtgcagaagaactacatgatttataactactgca 250
           |||||||||||||||| |||||||| ||||| |||||||
Sbjct: 906 aatgggtgcagaagaattacatgatctataattactgca 944


>gnl|LJGI|TC81330 similar to UniRef100_Q2HRU5 Cluster: Glycoside hydrolase, family
           16; Xyloglucan endo-transglycosylase, C- terminal; n=1;
           Medicago truncatula|Rep: Glycoside hydrolase, family 16;
           Xyloglucan endo-transglycosylase, C- terminal - Medicago
           truncatula (Barrel medic), complete
          Length = 936

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 22  tggaatgctgatgattgggccacaaggggaggtttggtgaagacagattgg 72
           |||||||| |||||||||||||||||||| ||||||| ||| ||| |||||
Sbjct: 577 tggaatgcagatgattgggccacaaggggtggtttggagaaaacaaattgg 627


>gnl|LJGI|TC58683 homologue to UniRef100_Q2HRU6 Cluster: Glycoside hydrolase, family
           16; Xyloglucan endo-transglycosylase, C- terminal; n=1;
           Medicago truncatula|Rep: Glycoside hydrolase, family 16;
           Xyloglucan endo-transglycosylase, C- terminal - Medicago
           truncatula (Barrel medic), complete
          Length = 1166

 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 22  tggaatgctgatgattgggccacaaggggaggtttggtgaagacagattgg 72
           |||||||| ||||||||||| |||||||| ||||||| ||| |||||||||
Sbjct: 601 tggaatgcagatgattgggcaacaaggggtggtttggagaaaacagattgg 651


>gnl|LJGI|TC68470 similar to UniRef100_P35694 Cluster: Brassinosteroid-regulated
           protein BRU1 precursor; n=1; Glycine max|Rep:
           Brassinosteroid-regulated protein BRU1 precursor -
           Glycine max (Soybean), partial (65%)
          Length = 775

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 12  ttctagcctttggaatgctgatgattgggccacaaggggaggtttggtgaagacagattg 71
           |||||||||||||| ||||||||| |||||||| || || || |||||||| || |||||
Sbjct: 290 ttctagcctttggagtgctgatgactgggccaccagaggtggattggtgaaaactgattg 349

            
Query: 72  g 72
           |
Sbjct: 350 g 350


>gnl|LJGI|TC59953 similar to UniRef100_P35694 Cluster: Brassinosteroid-regulated
           protein BRU1 precursor; n=1; Glycine max|Rep:
           Brassinosteroid-regulated protein BRU1 precursor -
           Glycine max (Soybean), partial (83%)
          Length = 849

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 12  ttctagcctttggaatgctgatgattgggccacaaggggaggtttggtgaagacagattg 71
           |||||||||||||| ||||||||| |||||||| || || || |||||||| || |||||
Sbjct: 602 ttctagcctttggagtgctgatgactgggccaccagaggtggattggtgaaaactgattg 661

            
Query: 72  g 72
           |
Sbjct: 662 g 662


>gnl|LJGI|TC69336 similar to UniRef100_A1YZ21 Cluster: Xyloglucan
           endotransglycosylase precursor; n=1; Populus tremula x
           Populus tremuloides|Rep: Xyloglucan endotransglycosylase
           precursor - Populus tremula x Populus tremuloides,
           partial (91%)
          Length = 1162

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 22  tggaatgctgatgattgggccacaaggggaggtttggtgaagacagattggagtcaagcc 81
           |||||||| |||||||||||||||  ||| |||   ||||||||||||||||| || |||
Sbjct: 670 tggaatgcagatgattgggccacacagggtggtcgagtgaagacagattggagccacgcc 729

                       
Query: 82  ccattcactgcc 93
           || |||| ||||
Sbjct: 730 cctttcattgcc 741


>gnl|LJGI|TC62499 similar to UniRef100_A7Q6H5 Cluster: Chromosome chr11 scaffold_56,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr11 scaffold_56, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (89%)
          Length = 1133

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 16  agcctttggaatgctgatgattgggccacaaggggaggtttggtgaagacagattgg 72
           ||||| |||||||||||| ||||||| |||||||| ||  | || ||||||||||||
Sbjct: 660 agcctgtggaatgctgataattgggcaacaaggggtggactagtcaagacagattgg 716