Miyakogusa Predicted Gene

Lj4g3v2140210.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2140210.1 Non Chatacterized Hit- tr|I1LVK0|I1LVK0_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,63.68,0,Homeodomain-like,Homeodomain-like; no
description,Homeodomain-like; Homeodomain,Homeodomain;
homeobo,CUFF.50358.1
         (621 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW598498 homologue to UniRef100_Q45RR3 Cluster: Type II...    64   1e-09
gnl|LJGI|TC71361 homologue to UniRef100_Q39862 Cluster: Homeobox...    60   2e-08

>gnl|LJGI|BW598498 homologue to UniRef100_Q45RR3 Cluster: Type II homeodomain-leucine
           zipper protein; n=1; Medicago sativa|Rep: Type II
           homeodomain-leucine zipper protein - Medicago sativa
           (Alfalfa), partial (26%)
          Length = 487

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 325 gaagtttggtttcagaacagaagagcaaggacaaagctgaagaagacagaggtgga 380
           ||||| ||||| || ||||||||||||||||| ||||||||| ||||||| |||||
Sbjct: 24  gaagtctggttccaaaacagaagagcaaggactaagctgaagcagacagaagtgga 79


>gnl|LJGI|TC71361 homologue to UniRef100_Q39862 Cluster: Homeobox-leucine zipper
           protein; n=1; Glycine max|Rep: Homeobox-leucine zipper
           protein - Glycine max (Soybean), partial (33%)
          Length = 706

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 317 gacaaattgaagtttggtttcagaacagaagagcaaggacaaagctgaag 366
           ||||| |||| || ||||| |||||||||||||||||||| |||||||||
Sbjct: 86  gacaagttgaggtgtggttccagaacagaagagcaaggactaagctgaag 135