Miyakogusa Predicted Gene

Lj4g3v2121810.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2121810.1 tr|Q66KP7|Q66KP7_XENLA MGC85550 protein
OS=Xenopus laevis GN=rps28p9 PE=4 SV=1,77.05,2e-19,no
description,Nucleic acid-binding, OB-fold; seg,NULL;
RIBOSOMAL_S28E,Ribosomal protein S28e; 40S R,93501_g.1
         (198 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69579 homologue to UniRef100_Q2HWC2 Cluster: Ribosoma...   392   e-109
gnl|LJGI|TC73907 homologue to UniRef100_Q2HWC2 Cluster: Ribosoma...   250   3e-66

>gnl|LJGI|TC69579 homologue to UniRef100_Q2HWC2 Cluster: Ribosomal protein S28e; n=1;
           Medicago truncatula|Rep: Ribosomal protein S28e -
           Medicago truncatula (Barrel medic), complete
          Length = 593

 Score =  392 bits (198), Expect = e-109
 Identities = 198/198 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggaatctcaggtgaagcatgctatcgtggtcaaaattatgggccgtactgggtctagg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 91  atggaatctcaggtgaagcatgctatcgtggtcaaaattatgggccgtactgggtctagg 150

                                                                       
Query: 61  ggtcaagtgactcaagtcagagtcaagtttttggatgaccagaatcgtcacatcatgagg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 151 ggtcaagtgactcaagtcagagtcaagtttttggatgaccagaatcgtcacatcatgagg 210

                                                                       
Query: 121 aacgtcaaaggaccagtcagggaaggtgacatcctcacccttctcgagtctgagagagaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 211 aacgtcaaaggaccagtcagggaaggtgacatcctcacccttctcgagtctgagagagaa 270

                             
Query: 181 gcaagaaggttgcgctag 198
           ||||||||||||||||||
Sbjct: 271 gcaagaaggttgcgctag 288


>gnl|LJGI|TC73907 homologue to UniRef100_Q2HWC2 Cluster: Ribosomal protein S28e; n=1;
           Medicago truncatula|Rep: Ribosomal protein S28e -
           Medicago truncatula (Barrel medic), complete
          Length = 746

 Score =  250 bits (126), Expect = 3e-66
 Identities = 180/198 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggaatctcaggtgaagcatgctatcgtggtcaaaattatgggccgtactgggtctagg 60
           ||||| |||||||||||||||||||| || |||||||||||||| |||||||| || || 
Sbjct: 85  atggagtctcaggtgaagcatgctattgttgtcaaaattatgggtcgtactggatccaga 144

                                                                       
Query: 61  ggtcaagtgactcaagtcagagtcaagtttttggatgaccagaatcgtcacatcatgagg 120
           ||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 145 ggtcaggtcactcaagtcagagttaagtttttggatgaccagaatcgtcacatcatgagg 204

                                                                       
Query: 121 aacgtcaaaggaccagtcagggaaggtgacatcctcacccttctcgagtctgagagagaa 180
           ||||| ||||| ||||| |||||||| ||||| ||||||||||| |||||||| ||||||
Sbjct: 205 aacgtgaaaggtccagtgagggaaggggacattctcacccttcttgagtctgaaagagaa 264

                             
Query: 181 gcaagaaggttgcgctag 198
           || |||||||||||||||
Sbjct: 265 gccagaaggttgcgctag 282