Miyakogusa Predicted Gene

Lj4g3v2120510.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2120510.1 Non Chatacterized Hit- tr|B3H692|B3H692_ARATH
Uncharacterized protein OS=Arabidopsis thaliana
GN=At2,31.84,5e-18,seg,NULL,CUFF.50272.1
         (622 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO023777                                                      88   8e-17

>gnl|LJGI|GO023777 
          Length = 485

 Score = 87.7 bits (44), Expect = 8e-17
 Identities = 68/76 (89%)
 Strand = Plus / Plus

                                                                       
Query: 185 atgaagtggacatggcaatggtgttctcagcacaaggttttgcatggagtgaaggtctta 244
           |||||||||||||||||||||||| |||||| ||||| |||||||||||| |   ||| |
Sbjct: 335 atgaagtggacatggcaatggtgtcctcagcccaaggctttgcatggagtaattctctca 394

                           
Query: 245 aactcaagcttcaaaa 260
           ||||||||||||||||
Sbjct: 395 aactcaagcttcaaaa 410



 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                       
Query: 19  aaacgcagacgcgtttattcattggaaccaagcaaagtagtgcaatctttatttgctaga 78
           ||||| ||||||||||| ||| | ||||||| |||||||||  || |   ||||||||||
Sbjct: 190 aaacgtagacgcgtttactcagttgaaccaaacaaagtagtagaagcagcatttgctaga 249

                                                      
Query: 79  aattatttgaactacttagttccagcattgatgaagataaagg 121
           || ||  ||||||| ||||||||||| ||||||||||| ||||
Sbjct: 250 aactacatgaactatttagttccagccttgatgaagatcaagg 292