Miyakogusa Predicted Gene
- Lj4g3v2093790.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2093790.1 tr|C1GAD3|C1GAD3_PARBD Negative regulator of the
PHO system OS=Paracoccidioides brasiliensis
(strain,28.92,9,seg,NULL,CUFF.50238.1
(451 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS321888 similar to UniRef100_A1KAM8 Cluster: Glycosylt... 70 1e-11
gnl|LJGI|BP046295 similar to UniRef100_A6ANT1 Cluster: Transcrip... 62 3e-09
gnl|LJGI|TC69531 62 3e-09
gnl|LJGI|TC67292 62 3e-09
gnl|LJGI|FS345020 similar to UniRef100_Q4RPI6 Cluster: Chromosom... 58 5e-08
gnl|LJGI|TC66328 weakly similar to UniRef100_A9UNR8 Cluster: Pre... 52 3e-06
gnl|LJGI|TC58604 similar to UniRef100_P09694 Cluster: Uncharacte... 52 3e-06
>gnl|LJGI|FS321888 similar to UniRef100_A1KAM8 Cluster: Glycosyltransferase; n=1;
Azoarcus sp. BH72|Rep: Glycosyltransferase - Azoarcus
sp. (strain BH72), partial (5%)
Length = 699
Score = 69.9 bits (35), Expect = 1e-11
Identities = 99/119 (83%), Gaps = 1/119 (0%)
Strand = Plus / Plus
Query: 68 gcagaaagaagatggcgccctcgccgggtcaccgctccga-tggtggctcggtgtcgtgg 126
||||||||| |||| |||||||| || |||||||| || |||||||| ||||||||||
Sbjct: 292 gcagaaagaggatgacgccctcgtcgagtcaccgccgagaatggtggcttggtgtcgtgg 351
Query: 127 cagttcattctcaggcaaccttcactaaccctcaccagagcatcgccgaagggtggtgg 185
||| || || ||| ||| |||||||||||| || ||||||||||||| ||||||||
Sbjct: 352 cagcatgttttcgggccaccctcactaaccctcgccggagcatcgccgaaaggtggtgg 410
>gnl|LJGI|BP046295 similar to UniRef100_A6ANT1 Cluster: Transcriptional regulatory
protein, C; n=1; Vibrio harveyi HY01|Rep:
Transcriptional regulatory protein, C - Vibrio harveyi
HY01, partial (7%)
Length = 415
Score = 61.9 bits (31), Expect = 3e-09
Identities = 59/67 (88%), Gaps = 1/67 (1%)
Strand = Plus / Plus
Query: 144 accttcactaaccctcaccagagcatcgccgaagggtggtggttttgagtgtcgtggttg 203
|||||||||||||||| || ||||||||||||| |||||||| ||| | || |||||||
Sbjct: 276 accttcactaaccctcgccggagcatcgccgaaaggtggtggcttt-tgcgttgtggttg 334
Query: 204 tgttgct 210
|||||||
Sbjct: 335 tgttgct 341
>gnl|LJGI|TC69531
Length = 678
Score = 61.9 bits (31), Expect = 3e-09
Identities = 59/67 (88%), Gaps = 1/67 (1%)
Strand = Plus / Minus
Query: 144 accttcactaaccctcaccagagcatcgccgaagggtggtggttttgagtgtcgtggttg 203
|||||||||||||||| || ||||||||||||| |||||||| ||| | || |||||||
Sbjct: 323 accttcactaaccctcgccggagcatcgccgaaaggtggtggcttt-tgcgttgtggttg 265
Query: 204 tgttgct 210
|||||||
Sbjct: 264 tgttgct 258
>gnl|LJGI|TC67292
Length = 880
Score = 61.9 bits (31), Expect = 3e-09
Identities = 98/119 (82%), Gaps = 1/119 (0%)
Strand = Plus / Minus
Query: 68 gcagaaagaagatggcgccctcgccgggtcaccgctccga-tggtggctcggtgtcgtgg 126
||||||||| |||| ||||||||||| |||||||| || |||||||| ||||||||||
Sbjct: 432 gcagaaagaggatgacgccctcgccgagtcaccgccgagagtggtggcttggtgtcgtgg 373
Query: 127 cagttcattctcaggcaaccttcactaaccctcaccagagcatcgccgaagggtggtgg 185
||| || || ||| ||| ||||||||||| || |||||||| |||| ||||||||
Sbjct: 372 cagcgtgttttcgggccacccacactaaccctcgccggagcatcgtcgaaaggtggtgg 314
>gnl|LJGI|FS345020 similar to UniRef100_Q4RPI6 Cluster: Chromosome 12 SCAF15007 whole
genome shotgun sequence; n=1; Tetraodon
nigroviridis|Rep:, partial (2%)
Length = 677
Score = 58.0 bits (29), Expect = 5e-08
Identities = 57/65 (87%), Gaps = 1/65 (1%)
Strand = Plus / Plus
Query: 146 cttcactaaccctcaccagagcatcgccgaagggtggtggttttgagtgtcgtggttgtg 205
|||||||||||||| || ||||||||||||| |||||||| ||| | || |||||||||
Sbjct: 515 cttcactaaccctcgccggagcatcgccgaaaggtggtggcttt-tgcgttgtggttgtg 573
Query: 206 ttgct 210
|||||
Sbjct: 574 ttgct 578
>gnl|LJGI|TC66328 weakly similar to UniRef100_A9UNR8 Cluster: Predicted protein; n=1;
Monosiga brevicollis MX1|Rep: Predicted protein -
Monosiga brevicollis MX1, partial (10%)
Length = 609
Score = 52.0 bits (26), Expect = 3e-06
Identities = 38/42 (90%)
Strand = Plus / Minus
Query: 144 accttcactaaccctcaccagagcatcgccgaagggtggtgg 185
|||||||||||||||| | ||||||||||||| ||||||||
Sbjct: 337 accttcactaaccctcgtcggagcatcgccgaaaggtggtgg 296
>gnl|LJGI|TC58604 similar to UniRef100_P09694 Cluster: Uncharacterized protein IRL4;
n=1; Human herpesvirus 5 strain AD169|Rep:
Uncharacterized protein IRL4 - Human cytomegalovirus
(strain AD169) (HHV-5) (Human herpesvirus 5), partial
(12%)
Length = 1221
Score = 52.0 bits (26), Expect = 3e-06
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 299 ctgcttcgcccccgccagaccgccgtcgaagggc 332
|||||| ||||||||| |||||||||||||||||
Sbjct: 55 ctgcttggcccccgccggaccgccgtcgaagggc 22