Miyakogusa Predicted Gene
- Lj4g3v2080390.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2080390.2 Non Chatacterized Hit- tr|I1MST3|I1MST3_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.32379 PE,90.15,0,FGGY
CARBOHYDRATE KINASE DOMAIN-CONTAINING PROTEIN,NULL; SUGAR KINASE,NULL;
FGGY_C,Carbohydrate kina,CUFF.50200.2
(822 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC58687 similar to UniRef100_Q67Y17 Cluster: MRNA, comp... 184 6e-46
gnl|LJGI|TC62549 similar to UniRef100_Q67Y17 Cluster: MRNA, comp... 178 4e-44
>gnl|LJGI|TC58687 similar to UniRef100_Q67Y17 Cluster: MRNA, complete cds, clone:
RAFL25-18-P16; n=1; Arabidopsis thaliana|Rep: MRNA,
complete cds, clone: RAFL25-18-P16 - Arabidopsis
thaliana (Mouse-ear cress), partial (39%)
Length = 788
Score = 184 bits (93), Expect = 6e-46
Identities = 93/93 (100%)
Strand = Plus / Plus
Query: 1 atgcaacatattgacgataaaaattcccgagatatggaagcttgcgggtgggatgatgac 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 696 atgcaacatattgacgataaaaattcccgagatatggaagcttgcgggtgggatgatgac 755
Query: 61 ttttgggaagaaattggtttgggtgatcttgtt 93
|||||||||||||||||||||||||||||||||
Sbjct: 756 ttttgggaagaaattggtttgggtgatcttgtt 788
>gnl|LJGI|TC62549 similar to UniRef100_Q67Y17 Cluster: MRNA, complete cds, clone:
RAFL25-18-P16; n=1; Arabidopsis thaliana|Rep: MRNA,
complete cds, clone: RAFL25-18-P16 - Arabidopsis
thaliana (Mouse-ear cress), partial (22%)
Length = 708
Score = 178 bits (90), Expect = 4e-44
Identities = 90/90 (100%)
Strand = Plus / Plus
Query: 733 actttgcagggcattgcatatggcacacgtcacattgtagagcattgcaacgcacatggt 792
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 actttgcagggcattgcatatggcacacgtcacattgtagagcattgcaacgcacatggt 60
Query: 793 cacaaaatcaacacactacttgcatgtggt 822
||||||||||||||||||||||||||||||
Sbjct: 61 cacaaaatcaacacactacttgcatgtggt 90