Miyakogusa Predicted Gene
- Lj4g3v2046230.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2046230.1 Non Chatacterized Hit- tr|I1MSU3|I1MSU3_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,89.9,0,Transketolase,
pyrimidine binding domain,Transketolase-like, pyrimidine-binding
domain; TRANSKETOLAS,CUFF.50183.1
(1251 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64910 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-... 66 6e-10
gnl|LJGI|TC73631 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-... 62 9e-09
gnl|LJGI|TC66644 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-... 62 9e-09
>gnl|LJGI|TC64910 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose 5-phosphate
synthase 2 precursor; n=1; Medicago truncatula|Rep:
1-deoxy-D-xylulose 5-phosphate synthase 2 precursor -
Medicago truncatula (Barrel medic), partial (17%)
Length = 654
Score = 65.9 bits (33), Expect = 6e-10
Identities = 63/73 (86%)
Strand = Plus / Plus
Query: 979 gctagagagcatgaaattctcatcacagtggaagagggatctattggagggtttggttct 1038
|||| |||||||||||| || ||||||||||| || || ||||||||||| ||||| ||
Sbjct: 113 gctaaagagcatgaaatactaatcacagtggaggaaggttctattggaggctttggatcg 172
Query: 1039 catgtttctcaat 1051
|||||||| ||||
Sbjct: 173 catgtttcacaat 185
>gnl|LJGI|TC73631 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-D-xylulose 5-phosphate
synthase; n=1; Pueraria montana var. lobata|Rep:
1-deoxy-D-xylulose 5-phosphate synthase - Pueraria lobata
(Kudzu vine), partial (19%)
Length = 584
Score = 61.9 bits (31), Expect = 9e-09
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 995 ttctcatcacagtggaagagggatctattggagggtttggttctcatgtttctca 1049
|||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||
Sbjct: 169 ttctgatcacagtagaagaaggatcaattggaggatttggttctcatgttgctca 223
>gnl|LJGI|TC66644 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-D-xylulose 5-phosphate
synthase; n=1; Pueraria montana var. lobata|Rep:
1-deoxy-D-xylulose 5-phosphate synthase - Pueraria lobata
(Kudzu vine), partial (23%)
Length = 615
Score = 61.9 bits (31), Expect = 9e-09
Identities = 49/55 (89%)
Strand = Plus / Plus
Query: 995 ttctcatcacagtggaagagggatctattggagggtttggttctcatgtttctca 1049
|||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||
Sbjct: 253 ttctgatcacagtagaagaaggatcaattggaggatttggttctcatgttgctca 307