Miyakogusa Predicted Gene

Lj4g3v2046230.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2046230.1 Non Chatacterized Hit- tr|I1MSU3|I1MSU3_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,89.9,0,Transketolase,
pyrimidine binding domain,Transketolase-like, pyrimidine-binding
domain; TRANSKETOLAS,CUFF.50183.1
         (1251 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64910 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-...    66   6e-10
gnl|LJGI|TC73631 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-...    62   9e-09
gnl|LJGI|TC66644 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-...    62   9e-09

>gnl|LJGI|TC64910 similar to UniRef100_Q8L692 Cluster: 1-deoxy-D-xylulose 5-phosphate
            synthase 2 precursor; n=1; Medicago truncatula|Rep:
            1-deoxy-D-xylulose 5-phosphate synthase 2 precursor -
            Medicago truncatula (Barrel medic), partial (17%)
          Length = 654

 Score = 65.9 bits (33), Expect = 6e-10
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                        
Query: 979  gctagagagcatgaaattctcatcacagtggaagagggatctattggagggtttggttct 1038
            |||| |||||||||||| || ||||||||||| || || ||||||||||| ||||| || 
Sbjct: 113  gctaaagagcatgaaatactaatcacagtggaggaaggttctattggaggctttggatcg 172

                         
Query: 1039 catgtttctcaat 1051
            |||||||| ||||
Sbjct: 173  catgtttcacaat 185


>gnl|LJGI|TC73631 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-D-xylulose 5-phosphate
            synthase; n=1; Pueraria montana var. lobata|Rep:
            1-deoxy-D-xylulose 5-phosphate synthase - Pueraria lobata
            (Kudzu vine), partial (19%)
          Length = 584

 Score = 61.9 bits (31), Expect = 9e-09
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                   
Query: 995  ttctcatcacagtggaagagggatctattggagggtttggttctcatgtttctca 1049
            |||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||
Sbjct: 169  ttctgatcacagtagaagaaggatcaattggaggatttggttctcatgttgctca 223


>gnl|LJGI|TC66644 homologue to UniRef100_Q6EJC9 Cluster: 1-deoxy-D-xylulose 5-phosphate
            synthase; n=1; Pueraria montana var. lobata|Rep:
            1-deoxy-D-xylulose 5-phosphate synthase - Pueraria lobata
            (Kudzu vine), partial (23%)
          Length = 615

 Score = 61.9 bits (31), Expect = 9e-09
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                   
Query: 995  ttctcatcacagtggaagagggatctattggagggtttggttctcatgtttctca 1049
            |||| |||||||| ||||| ||||| |||||||| ||||||||||||||| ||||
Sbjct: 253  ttctgatcacagtagaagaaggatcaattggaggatttggttctcatgttgctca 307