Miyakogusa Predicted Gene

Lj4g3v2000920.4
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2000920.4 Non Chatacterized Hit- tr|C5XUE6|C5XUE6_SORBI
Putative uncharacterized protein Sb04g035740
OS=Sorghu,32.64,0.00000000000002,DUF566,Protein of unknown function
DUF566; FAMILY NOT NAMED,NULL; seg,NULL,CUFF.50076.4
         (1569 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76976 weakly similar to UniRef100_A7PFN8 Cluster: Chr...    80   5e-14

>gnl|LJGI|TC76976 weakly similar to UniRef100_A7PFN8 Cluster: Chromosome chr11
            scaffold_14, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome chr11 scaffold_14, whole genome
            shotgun sequence - Vitis vinifera (Grape), partial (20%)
          Length = 739

 Score = 79.8 bits (40), Expect = 5e-14
 Identities = 94/112 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1406 ttttgaatgatcaaatgacctacctggatgactgggctgtaattgaaactgatcatgttg 1465
            ||||||||||||||||| ||||||| ||||| ||||||    |||| || ||||||||||
Sbjct: 5    ttttgaatgatcaaatggcctaccttgatgaatgggctacgcttgagacagatcatgttg 64

                                                                
Query: 1466 atgctctatctggggctatagaagacttagaggccagcactcttcgtcttcc 1517
            | |||||||| || ||| | ||||| || ||||| ||||| |||||||||||
Sbjct: 65   acgctctatccggtgctgtggaagatttggaggcgagcacccttcgtcttcc 116