Miyakogusa Predicted Gene

Lj4g3v1983680.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1983680.1 Non Chatacterized Hit- tr|B9STT6|B9STT6_RICCO
Putative uncharacterized protein OS=Ricinus communis
G,31.48,3e-16,seg,NULL; C2H2 and C2HC zinc fingers,NULL; U1-like zinc
finger,Zinc finger, U1-type; zinc finger,Zin,CUFF.50060.1
         (2010 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78022                                                      260   3e-68

>gnl|LJGI|TC78022 
          Length = 509

 Score =  260 bits (131), Expect = 3e-68
 Identities = 152/158 (96%), Gaps = 1/158 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1854 tgggaaaacaaacgcgttggtggggaggaagagggagttatggtgtgacatttgtggaat 1913
            ||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    tgggaaaacnaacgctttgttggggaggaagagggagttatggtgtgacatttgtggaat 60

                                                                        
Query: 1914 tagtgctacctctcaacttcagatggaagaccacaaaaaagggagcaaacatcgtagacg 1973
            ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 61   tagtgctacctctcaacttcagatggaagaccacataaaagggagcaaacatcgtagacg 120

                                                  
Query: 1974 aatggagctcacatcct-atgcagataaatttttatga 2010
            ||||||||||||||||| |||||||| |||||||||||
Sbjct: 121  aatggagctcacatcctgatgcagatgaatttttatga 158