Miyakogusa Predicted Gene

Lj4g3v1983570.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1983570.2 Non Chatacterized Hit- tr|B9STR2|B9STR2_RICCO
Putative uncharacterized protein OS=Ricinus communis G,76.47,1e-16,
,CUFF.50056.2
         (390 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70496 similar to UniRef100_A7PFS0 Cluster: Chromosome...   202   1e-51

>gnl|LJGI|TC70496 similar to UniRef100_A7PFS0 Cluster: Chromosome chr11 scaffold_14,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr11 scaffold_14, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (78%)
          Length = 766

 Score =  202 bits (102), Expect = 1e-51
 Identities = 114/117 (97%), Gaps = 2/117 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatgaattcagtcctcgtgcccgtagaagaagtgctttactcacatggcaacacatt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 641 atggatgaattcagtcctcgtgcccgtagaagaagtgctttactcacatggcaacacatt 700

                                                                    
Query: 61  gcatccttacctcctagcctgccagttgtgtactgtggaggattcaacacacaaaag 117
           ||||||||||||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 701 gcatccttacctcctagcctgccagttgtgtactgtggag--atcaacacacaaaag 755