Miyakogusa Predicted Gene
- Lj4g3v1983570.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1983570.2 Non Chatacterized Hit- tr|B9STR2|B9STR2_RICCO
Putative uncharacterized protein OS=Ricinus communis G,76.47,1e-16,
,CUFF.50056.2
(390 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC70496 similar to UniRef100_A7PFS0 Cluster: Chromosome... 202 1e-51
>gnl|LJGI|TC70496 similar to UniRef100_A7PFS0 Cluster: Chromosome chr11 scaffold_14,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr11 scaffold_14, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (78%)
Length = 766
Score = 202 bits (102), Expect = 1e-51
Identities = 114/117 (97%), Gaps = 2/117 (1%)
Strand = Plus / Plus
Query: 1 atggatgaattcagtcctcgtgcccgtagaagaagtgctttactcacatggcaacacatt 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 641 atggatgaattcagtcctcgtgcccgtagaagaagtgctttactcacatggcaacacatt 700
Query: 61 gcatccttacctcctagcctgccagttgtgtactgtggaggattcaacacacaaaag 117
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 701 gcatccttacctcctagcctgccagttgtgtactgtggag--atcaacacacaaaag 755