Miyakogusa Predicted Gene

Lj4g3v1883040.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1883040.1 Non Chatacterized Hit- tr|I1LZR6|I1LZR6_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,82.76,0.000001,
,TC68633.path1.1
         (120 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS331311 weakly similar to UniRef100_Q2HSY3 Cluster: Nu...   238   6e-63
gnl|LJGI|TC68633 weakly similar to UniRef100_Q2HSY3 Cluster: Nuc...   238   6e-63
gnl|LJGI|TC67858 similar to UniRef100_A4Q7L7 Cluster: Mak10 subu...   238   6e-63

>gnl|LJGI|FS331311 weakly similar to UniRef100_Q2HSY3 Cluster: Nucleic acid-binding,
           OB-fold, subgroup; n=1; Medicago truncatula|Rep: Nucleic
           acid-binding, OB-fold, subgroup - Medicago truncatula
           (Barrel medic), partial (30%)
          Length = 710

 Score =  238 bits (120), Expect = 6e-63
 Identities = 120/120 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctcacgatcgcaccgatgatgatgcatccgccaacgttcctccaaccgcctccatt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 40  atggctcacgatcgcaccgatgatgatgcatccgccaacgttcctccaaccgcctccatt 99

                                                                       
Query: 61  ccctccggcgacaactccgtctgggccgatgtatcgccgcttctccaatccgcttgccaa 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 100 ccctccggcgacaactccgtctgggccgatgtatcgccgcttctccaatccgcttgccaa 159


>gnl|LJGI|TC68633 weakly similar to UniRef100_Q2HSY3 Cluster: Nucleic acid-binding,
           OB-fold, subgroup; n=1; Medicago truncatula|Rep: Nucleic
           acid-binding, OB-fold, subgroup - Medicago truncatula
           (Barrel medic), partial (30%)
          Length = 788

 Score =  238 bits (120), Expect = 6e-63
 Identities = 120/120 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctcacgatcgcaccgatgatgatgcatccgccaacgttcctccaaccgcctccatt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 115 atggctcacgatcgcaccgatgatgatgcatccgccaacgttcctccaaccgcctccatt 174

                                                                       
Query: 61  ccctccggcgacaactccgtctgggccgatgtatcgccgcttctccaatccgcttgccaa 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 175 ccctccggcgacaactccgtctgggccgatgtatcgccgcttctccaatccgcttgccaa 234


>gnl|LJGI|TC67858 similar to UniRef100_A4Q7L7 Cluster: Mak10 subunit, NatC
           N(Alpha)-terminal acetyltransferase; n=1; Medicago
           truncatula|Rep: Mak10 subunit, NatC N(Alpha)-terminal
           acetyltransferase - Medicago truncatula (Barrel medic),
           partial (33%)
          Length = 737

 Score =  238 bits (120), Expect = 6e-63
 Identities = 120/120 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggctcacgatcgcaccgatgatgatgcatccgccaacgttcctccaaccgcctccatt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 40  atggctcacgatcgcaccgatgatgatgcatccgccaacgttcctccaaccgcctccatt 99

                                                                       
Query: 61  ccctccggcgacaactccgtctgggccgatgtatcgccgcttctccaatccgcttgccaa 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 100 ccctccggcgacaactccgtctgggccgatgtatcgccgcttctccaatccgcttgccaa 159