Miyakogusa Predicted Gene
- Lj4g3v1881550.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1881550.1 Non Chatacterized Hit- tr|I1MU62|I1MU62_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.42558
PE,97.56,0,Pkinase,Protein kinase, catalytic domain; no
description,NULL;
PROTEIN_KINASE_ST,Serine/threonine-pr,
NODE_4626_length_740_cov_87.191895.path1.1
(369 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC62983 149 1e-35
gnl|LJGI|TC66119 similar to UniRef100_A7QPC2 Cluster: Chromosome... 68 4e-11
gnl|LJGI|TC65945 similar to UniRef100_A7QPC2 Cluster: Chromosome... 68 4e-11
gnl|LJGI|BW624909 homologue to UniRef100_Q84QD9 Cluster: Avr9/Cf... 66 2e-10
gnl|LJGI|TC74279 similar to UniRef100_Q5XWQ1 Cluster: Serine/thr... 62 3e-09
gnl|LJGI|TC69630 similar to UniRef100_A7PN67 Cluster: Chromosome... 54 6e-07
gnl|LJGI|TC61612 similar to UniRef100_Q9LKY3 Cluster: Pti1 kinas... 54 6e-07
gnl|LJGI|TC81310 similar to UniRef100_Q9ZT08 Cluster: Receptor-l... 52 2e-06
gnl|LJGI|TC59486 similar to UniRef100_A7PDW6 Cluster: Chromosome... 52 2e-06
>gnl|LJGI|TC62983
Length = 695
Score = 149 bits (75), Expect = 1e-35
Identities = 75/75 (100%)
Strand = Plus / Plus
Query: 295 ggacacttgacttcaaaaagtgatgtttatagctttggagttgtgttgcttgagatttta 354
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 253 ggacacttgacttcaaaaagtgatgtttatagctttggagttgtgttgcttgagatttta 312
Query: 355 acaggaagaagatcg 369
|||||||||||||||
Sbjct: 313 acaggaagaagatcg 327
>gnl|LJGI|TC66119 similar to UniRef100_A7QPC2 Cluster: Chromosome chr18 scaffold_137,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr18 scaffold_137, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (46%)
Length = 767
Score = 67.9 bits (34), Expect = 4e-11
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 127 gtcatctacagagatttcaaaacatcaaacattttgcttgatacggagtataatgcaaag 186
|||||||||||||||||||| | || |||||||| ||||||| ||| | |||||||||
Sbjct: 682 gtcatctacagagatttcaagtcctccaacattttacttgatagggatttcaatgcaaag 741
Query: 187 ctttcagattttgg 200
||||| ||||||||
Sbjct: 742 ctttccgattttgg 755
>gnl|LJGI|TC65945 similar to UniRef100_A7QPC2 Cluster: Chromosome chr18 scaffold_137,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr18 scaffold_137, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (83%)
Length = 1516
Score = 67.9 bits (34), Expect = 4e-11
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 127 gtcatctacagagatttcaaaacatcaaacattttgcttgatacggagtataatgcaaag 186
|||||||||||||||||||| | || |||||||| ||||||| ||| | |||||||||
Sbjct: 624 gtcatctacagagatttcaagtcctccaacattttacttgatagggatttcaatgcaaag 683
Query: 187 ctttcagattttgg 200
||||| ||||||||
Sbjct: 684 ctttccgattttgg 697
>gnl|LJGI|BW624909 homologue to UniRef100_Q84QD9 Cluster: Avr9/Cf-9 induced kinase 1;
n=1; Nicotiana tabacum|Rep: Avr9/Cf-9 induced kinase 1 -
Nicotiana tabacum (Common tobacco), partial (35%)
Length = 477
Score = 65.9 bits (33), Expect = 2e-10
Identities = 162/205 (79%)
Strand = Plus / Plus
Query: 122 aaccagtcatctacagagatttcaaaacatcaaacattttgcttgatacggagtataatg 181
||||||||||||| || ||||||||| | |||||||| ||| | || | || | ||||
Sbjct: 270 aaccagtcatctatagggatttcaaagcttcaaacatcttgttagactctgaccacaatg 329
Query: 182 caaagctttcagattttggtctagcaaaagcaggccctcagggggacaaaacacatgttt 241
||||||| || |||||||| | ||||||| || ||| | || || | ||||||||||
Sbjct: 330 caaagctctctgattttgggttggcaaaagatggtcctgaaggagatgacacacatgttt 389
Query: 242 ctactagagttgttggcacttatggttatgctgctccagaatacgtcatgacaggacact 301
| ||||||||| | ||||| | || ||||| || ||||||||| ||||||||||||| |
Sbjct: 390 ccactagagttatgggcacacaagggtatgcagcaccagaatacatcatgacaggacatt 449
Query: 302 tgacttcaaaaagtgatgtttatag 326
|||| ||| |||||||| |||||
Sbjct: 450 tgacagcaatgagtgatgtgtatag 474
>gnl|LJGI|TC74279 similar to UniRef100_Q5XWQ1 Cluster: Serine/threonine protein
kinase-like; n=1; Solanum tuberosum|Rep:
Serine/threonine protein kinase-like - Solanum tuberosum
(Potato), partial (33%)
Length = 921
Score = 61.9 bits (31), Expect = 3e-09
Identities = 151/191 (79%)
Strand = Plus / Plus
Query: 178 aatgcaaagctttcagattttggtctagcaaaagcaggccctcagggggacaaaacacat 237
||||| ||||| ||||| ||||| || ||||||| || || |||| || ||||| |||
Sbjct: 11 aatgccaagctctcagactttggacttgcaaaagatggtccagagggtgataaaacccat 70
Query: 238 gtttctactagagttgttggcacttatggttatgctgctccagaatacgtcatgacagga 297
|| |||||| |||| | || |||||||||||||| || || ||||| ||| ||||||||
Sbjct: 71 gtgtctactcgagtgatgggaacttatggttatgcagcacctgaatatgtcgtgacagga 130
Query: 298 cacttgacttcaaaaagtgatgtttatagctttggagttgtgttgcttgagattttaaca 357
|| | || |||| |||||| || ||||| |||||||| ||| | || ||||| || ||
Sbjct: 131 catcttacatcaagaagtgacgtgtatagttttggagtggtgcttctggagatgttgact 190
Query: 358 ggaagaagatc 368
|| ||||||||
Sbjct: 191 ggcagaagatc 201
>gnl|LJGI|TC69630 similar to UniRef100_A7PN67 Cluster: Chromosome chr1 scaffold_22,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr1 scaffold_22, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (15%)
Length = 671
Score = 54.0 bits (27), Expect = 6e-07
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 310 aaaagtgatgtttatagctttggagttgtgttgct 344
|||||||||||||||||||||||||| ||| ||||
Sbjct: 150 aaaagtgatgtttatagctttggagtggtgctgct 184
>gnl|LJGI|TC61612 similar to UniRef100_Q9LKY3 Cluster: Pti1 kinase-like protein; n=1;
Glycine max|Rep: Pti1 kinase-like protein - Glycine max
(Soybean), complete
Length = 1554
Score = 54.0 bits (27), Expect = 6e-07
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 304 acttcaaaaagtgatgtttatagctttggagttgt 338
|||||||||||||||||||| || |||||||||||
Sbjct: 931 acttcaaaaagtgatgtttacagttttggagttgt 965
>gnl|LJGI|TC81310 similar to UniRef100_Q9ZT08 Cluster: Receptor-like protein kinase;
n=1; Arabidopsis thaliana|Rep: Receptor-like protein
kinase - Arabidopsis thaliana (Mouse-ear cress), partial
(14%)
Length = 1152
Score = 52.0 bits (26), Expect = 2e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 1 atgacccgtggcagtctagaaaatcatctattcagaag 38
||||||||||| |||||||| |||| ||||||||||||
Sbjct: 496 atgacccgtggaagtctagacaatcttctattcagaag 533
>gnl|LJGI|TC59486 similar to UniRef100_A7PDW6 Cluster: Chromosome chr11 scaffold_13,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr11 scaffold_13, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (42%)
Length = 895
Score = 52.0 bits (26), Expect = 2e-06
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 122 aaccagtcatctacagagatttcaaa 147
||||||||||||||||||||||||||
Sbjct: 828 aaccagtcatctacagagatttcaaa 853