Miyakogusa Predicted Gene

Lj4g3v1879200.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1879200.1 tr|G7JCW8|G7JCW8_MEDTR Peroxidase OS=Medicago
truncatula GN=MTR_4g114210 PE=3 SV=1,86.76,0,PEROXIDASE_4,Haem
peroxidase, plant/fungal/bacterial; no description,NULL;
PLPEROXIDASE,Plant peroxi,CUFF.49790.1
         (408 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO010630 similar to UniRef100_A7PF42 Cluster: Chromosom...   252   1e-66
gnl|LJGI|TC69822 similar to UniRef100_Q9XFI7 Cluster: Peroxidase...    60   1e-08
gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic ...    52   3e-06

>gnl|LJGI|GO010630 similar to UniRef100_A7PF42 Cluster: Chromosome chr11 scaffold_13,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr11 scaffold_13, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (60%)
          Length = 713

 Score =  252 bits (127), Expect = 1e-66
 Identities = 235/271 (86%)
 Strand = Plus / Plus

                                                                       
Query: 126 atcctacttcaacaaagatcctaccattgctcctggactgctcaggcttcatttccatga 185
           |||||||||||| ||||| || |||||||||||| | ||||| |||||||||||||||||
Sbjct: 193 atcctacttcaataaagacccaaccattgctcctagcctgcttaggcttcatttccatga 252

                                                                       
Query: 186 ttgctttgtccagggctgcgatggttcaattctgattgcaggctcttctgcagagaggaa 245
           ||||||||| |||||||||||||||||| ||||||||| ||| || ||||||||| ||||
Sbjct: 253 ttgctttgttcagggctgcgatggttcagttctgattgtagggtcatctgcagagcggaa 312

                                                                       
Query: 246 tgcattgccaaaccttggcctaagaggttttgaagtgattgatgatgcaaaatctcaatt 305
           ||||||| |||||||| | ||||||||||||||||||||||| ||||||||||| ||| |
Sbjct: 313 tgcattggcaaaccttagtctaagaggttttgaagtgattgaagatgcaaaatcacaact 372

                                                                       
Query: 306 agaggccaaatgtcctggtgttgtttcatgtgctgatatcctagcattggcagcacgaga 365
            ||||| | ||| || |||||||| ||||| ||||| || |||||  |||||||||| ||
Sbjct: 373 tgaggcaatatgcccaggtgttgtctcatgcgctgacatactagctgtggcagcacgtga 432

                                          
Query: 366 tgctgttgatttgagtgatggcccaagttgg 396
           ||| ||  | |||||| |||| |||||||||
Sbjct: 433 tgcagtgtacttgagtaatggtccaagttgg 463


>gnl|LJGI|TC69822 similar to UniRef100_Q9XFI7 Cluster: Peroxidase; n=1; Glycine
           max|Rep: Peroxidase - Glycine max (Soybean), partial
           (92%)
          Length = 1245

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 164 tgctcaggcttcatttccatgattgctttgtccagggctgcgatggttcaattctgat 221
           |||||||||||||||| ||||| || |||||  |||| || |||||||||||||||||
Sbjct: 267 tgctcaggcttcattttcatgactgttttgttgagggatgtgatggttcaattctgat 324


>gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
           Stylosanthes humilis|Rep: Cationic peroxidase -
           Stylosanthes humilis (Townsville stylo), partial (43%)
          Length = 562

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 172 cttcatttccatgattgctttgtcca 197
           ||||||||||||||||||||||||||
Sbjct: 270 cttcatttccatgattgctttgtcca 295