Miyakogusa Predicted Gene
- Lj4g3v1879200.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1879200.1 tr|G7JCW8|G7JCW8_MEDTR Peroxidase OS=Medicago
truncatula GN=MTR_4g114210 PE=3 SV=1,86.76,0,PEROXIDASE_4,Haem
peroxidase, plant/fungal/bacterial; no description,NULL;
PLPEROXIDASE,Plant peroxi,CUFF.49790.1
(408 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO010630 similar to UniRef100_A7PF42 Cluster: Chromosom... 252 1e-66
gnl|LJGI|TC69822 similar to UniRef100_Q9XFI7 Cluster: Peroxidase... 60 1e-08
gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic ... 52 3e-06
>gnl|LJGI|GO010630 similar to UniRef100_A7PF42 Cluster: Chromosome chr11 scaffold_13,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr11 scaffold_13, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (60%)
Length = 713
Score = 252 bits (127), Expect = 1e-66
Identities = 235/271 (86%)
Strand = Plus / Plus
Query: 126 atcctacttcaacaaagatcctaccattgctcctggactgctcaggcttcatttccatga 185
|||||||||||| ||||| || |||||||||||| | ||||| |||||||||||||||||
Sbjct: 193 atcctacttcaataaagacccaaccattgctcctagcctgcttaggcttcatttccatga 252
Query: 186 ttgctttgtccagggctgcgatggttcaattctgattgcaggctcttctgcagagaggaa 245
||||||||| |||||||||||||||||| ||||||||| ||| || ||||||||| ||||
Sbjct: 253 ttgctttgttcagggctgcgatggttcagttctgattgtagggtcatctgcagagcggaa 312
Query: 246 tgcattgccaaaccttggcctaagaggttttgaagtgattgatgatgcaaaatctcaatt 305
||||||| |||||||| | ||||||||||||||||||||||| ||||||||||| ||| |
Sbjct: 313 tgcattggcaaaccttagtctaagaggttttgaagtgattgaagatgcaaaatcacaact 372
Query: 306 agaggccaaatgtcctggtgttgtttcatgtgctgatatcctagcattggcagcacgaga 365
||||| | ||| || |||||||| ||||| ||||| || ||||| |||||||||| ||
Sbjct: 373 tgaggcaatatgcccaggtgttgtctcatgcgctgacatactagctgtggcagcacgtga 432
Query: 366 tgctgttgatttgagtgatggcccaagttgg 396
||| || | |||||| |||| |||||||||
Sbjct: 433 tgcagtgtacttgagtaatggtccaagttgg 463
>gnl|LJGI|TC69822 similar to UniRef100_Q9XFI7 Cluster: Peroxidase; n=1; Glycine
max|Rep: Peroxidase - Glycine max (Soybean), partial
(92%)
Length = 1245
Score = 60.0 bits (30), Expect = 1e-08
Identities = 51/58 (87%)
Strand = Plus / Plus
Query: 164 tgctcaggcttcatttccatgattgctttgtccagggctgcgatggttcaattctgat 221
|||||||||||||||| ||||| || ||||| |||| || |||||||||||||||||
Sbjct: 267 tgctcaggcttcattttcatgactgttttgttgagggatgtgatggttcaattctgat 324
>gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
Stylosanthes humilis|Rep: Cationic peroxidase -
Stylosanthes humilis (Townsville stylo), partial (43%)
Length = 562
Score = 52.0 bits (26), Expect = 3e-06
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 172 cttcatttccatgattgctttgtcca 197
||||||||||||||||||||||||||
Sbjct: 270 cttcatttccatgattgctttgtcca 295