Miyakogusa Predicted Gene

Lj4g3v1877050.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1877050.1 Non Chatacterized Hit- tr|I1LZZ7|I1LZZ7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.44583
PE,71.66,0,HELICASE_ATP_BIND_1,Helicase, superfamily 1/2, ATP-binding
domain; HELICASE_CTER,Helicase,
C-termina,NODE_69233_length_1969_cov_11.275775.path2.1
         (1452 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69978 homologue to UniRef100_A7PCT3 Cluster: Chromoso...    70   4e-11

>gnl|LJGI|TC69978 homologue to UniRef100_A7PCT3 Cluster: Chromosome chr17
           scaffold_12, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr17 scaffold_12, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (59%)
          Length = 1175

 Score = 69.9 bits (35), Expect = 4e-11
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 370 taccttgctttggatgaagctgatcgcatgttggacatgggttttga 416
           |||||||  ||||||||||||||||| ||||||||||||||||||||
Sbjct: 47  taccttgtcttggatgaagctgatcgaatgttggacatgggttttga 93