Miyakogusa Predicted Gene
- Lj4g3v1614780.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1614780.1 tr|G7JPX7|G7JPX7_MEDTR Pectate lyase OS=Medicago
truncatula GN=MTR_4g107870 PE=4 SV=1,78.16,0,Pec_lyase_C,Pectate
lyase/Amb allergen; AMBALLERGEN,AmbAllergen; SUBFAMILY NOT NAMED,NULL;
FAMILY NO,gene.g55346.t1.1
(1107 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC77984 similar to UniRef100_Q40319 Cluster: Pectate ly... 94 2e-18
gnl|LJGI|GO032618 similar to UniRef100_A7PCL8 Cluster: Chromosom... 70 3e-11
gnl|LJGI|TC65970 similar to UniRef100_Q2Z1Y4 Cluster: Pectate ly... 60 3e-08
gnl|LJGI|TC74491 similar to UniRef100_Q9M505 Cluster: Pectate ly... 52 8e-06
>gnl|LJGI|TC77984 similar to UniRef100_Q40319 Cluster: Pectate lyase homolog; n=6;
Medicago sativa|Rep: Pectate lyase homolog - Medicago
sativa (Alfalfa), partial (90%)
Length = 1455
Score = 93.7 bits (47), Expect = 2e-18
Identities = 224/283 (79%)
Strand = Plus / Plus
Query: 542 tttggattgatcatatttctttgtccaattgtgatgatggtctagttgatgctgtggagg 601
|||||||||||||| |||| |||||| | ||||| |||||||| || || | | | |||
Sbjct: 685 tttggattgatcatctttccttgtccgaatgtgaggatggtcttgtcgacgttattcagg 744
Query: 602 gatcaacagctatcaccatctctaattgccacttgacccatcataatgatgttatgttgt 661
|||| || || ||||||||||| ||||||||| ||||| | || || ||||| |||||||
Sbjct: 745 gatctaccgcaatcaccatctcaaattgccacatgaccaaacacaacgatgtgatgttgt 804
Query: 662 ttggagcaagtgatgtgttttcaggagataaagtgtcgcaaataaccgtggctttcaacc 721
||||||| ||||| | || || || || | ||| || || ||||| |||||||
Sbjct: 805 ttggagctagtgacagctactctggtgacaagatcatgcagatcacagtggcgttcaacc 864
Query: 722 attttgggcaaggactggtacagaggatgccaaggtgcaggtggggtttctttcacgttg 781
| ||||| || || ||| | |||||||||||||||||||| ||||||||| | || ||
Sbjct: 865 actttggacagggtctgatccagaggatgccaaggtgcagatggggtttcgtccatgtgt 924
Query: 782 tcaacaatgactacactcactggctaatgtatgccattggtgg 824
| |||||||||||||| || ||||| ||||| || ||||||||
Sbjct: 925 tgaacaatgactacacccattggctgatgtacgcgattggtgg 967
>gnl|LJGI|GO032618 similar to UniRef100_A7PCL8 Cluster: Chromosome chr17 scaffold_12,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_12, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (42%)
Length = 714
Score = 69.9 bits (35), Expect = 3e-11
Identities = 98/119 (82%)
Strand = Plus / Plus
Query: 706 accgtggctttcaaccattttgggcaaggactggtacagaggatgccaaggtgcaggtgg 765
||||| || |||||||||||||| |||| || || |||||||||||||| |||||||
Sbjct: 100 accgttgccttcaaccattttggagaagggctagtgcagaggatgccaagatgcaggtat 159
Query: 766 ggtttctttcacgttgtcaacaatgactacactcactggctaatgtatgccattggtgg 824
|| | ||| || || || |||||||||||||| || ||| |||||||||||| |||||
Sbjct: 160 ggatacttccatgtggtaaacaatgactacacgcaatgggcaatgtatgccataggtgg 218
>gnl|LJGI|TC65970 similar to UniRef100_Q2Z1Y4 Cluster: Pectate lyase; n=1; Prunus
mume|Rep: Pectate lyase - Prunus mume (Japanese
flowering apricot), partial (92%)
Length = 1915
Score = 60.0 bits (30), Expect = 3e-08
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 784 aacaatgactacactcactggctaatgtatgccattgg 821
||||||||||||||||||||| |||||||||||||||
Sbjct: 948 aacaatgactacactcactgggaaatgtatgccattgg 985
>gnl|LJGI|TC74491 similar to UniRef100_Q9M505 Cluster: Pectate lyase; n=1; Vitis
vinifera|Rep: Pectate lyase - Vitis vinifera (Grape),
partial (62%)
Length = 899
Score = 52.0 bits (26), Expect = 8e-06
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 771 ctttcacgttgtcaacaatgactacactcactggctaatgtatgccattggtgg 824
|||||| || || |||||||||||||| |||||| ||||||||| ||||||||
Sbjct: 413 ctttcatgtggtgaacaatgactacacacactgggaaatgtatgcaattggtgg 466