Miyakogusa Predicted Gene
- Lj4g3v1614700.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1614700.1 Non Chatacterized Hit- tr|I1MTP9|I1MTP9_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,81.67,0,MFS general
substrate transporter,Major facilitator superfamily domain, general
substrate transporte,CUFF.49483.1
(915 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC61365 similar to UniRef100_O81393 Cluster: Nitrate tr... 70 3e-11
>gnl|LJGI|TC61365 similar to UniRef100_O81393 Cluster: Nitrate transporter NTL1; n=1;
Arabidopsis thaliana|Rep: Nitrate transporter NTL1 -
Arabidopsis thaliana (Mouse-ear cress), partial (38%)
Length = 750
Score = 69.9 bits (35), Expect = 3e-11
Identities = 80/95 (84%)
Strand = Plus / Plus
Query: 565 ttcaattactttgtcttcagcctctcatgtggggcattgattgcagtcacttttgtggtg 624
||||| |||||||| ||| |||| |||||||| || | ||||| || ||| ||||||||
Sbjct: 594 ttcaactactttgtgttctgcctatcatgtggtgcccttattgctgttactcttgtggtg 653
Query: 625 tggattgaagacaacaagggatggcagtggggttt 659
||| ||||||||||||| |||||| | ||||||||
Sbjct: 654 tgggttgaagacaacaaaggatgggaatggggttt 688
Score = 56.0 bits (28), Expect = 4e-07
Identities = 61/72 (84%)
Strand = Plus / Plus
Query: 210 tgtcaccaatttcatgggaacagctttcctccttgctattcttggtgggtttctggctga 269
|||||| |||||||||||||| || ||||||||||| |||||||||| || | | ||
Sbjct: 251 tgtcactaatttcatgggaaccgccttcctccttgcacttcttggtggtttcatatccga 310
Query: 270 tgcatttttcac 281
||||||||||||
Sbjct: 311 tgcatttttcac 322