Miyakogusa Predicted Gene

Lj4g3v1614700.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1614700.1 Non Chatacterized Hit- tr|I1MTP9|I1MTP9_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,81.67,0,MFS general
substrate transporter,Major facilitator superfamily domain, general
substrate transporte,CUFF.49483.1
         (915 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61365 similar to UniRef100_O81393 Cluster: Nitrate tr...    70   3e-11

>gnl|LJGI|TC61365 similar to UniRef100_O81393 Cluster: Nitrate transporter NTL1; n=1;
           Arabidopsis thaliana|Rep: Nitrate transporter NTL1 -
           Arabidopsis thaliana (Mouse-ear cress), partial (38%)
          Length = 750

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 565 ttcaattactttgtcttcagcctctcatgtggggcattgattgcagtcacttttgtggtg 624
           ||||| |||||||| ||| |||| |||||||| ||  | ||||| || ||| ||||||||
Sbjct: 594 ttcaactactttgtgttctgcctatcatgtggtgcccttattgctgttactcttgtggtg 653

                                              
Query: 625 tggattgaagacaacaagggatggcagtggggttt 659
           ||| ||||||||||||| |||||| | ||||||||
Sbjct: 654 tgggttgaagacaacaaaggatgggaatggggttt 688



 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 61/72 (84%)
 Strand = Plus / Plus

                                                                       
Query: 210 tgtcaccaatttcatgggaacagctttcctccttgctattcttggtgggtttctggctga 269
           |||||| |||||||||||||| || |||||||||||  |||||||||| ||  |  | ||
Sbjct: 251 tgtcactaatttcatgggaaccgccttcctccttgcacttcttggtggtttcatatccga 310

                       
Query: 270 tgcatttttcac 281
           ||||||||||||
Sbjct: 311 tgcatttttcac 322