Miyakogusa Predicted Gene

Lj4g3v1586920.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1586920.1 tr|G8A233|G8A233_MEDTR Nuclear transcription
factor Y subunit A-7 (Fragment) OS=Medicago truncatula ,39.39,1.7,
,CUFF.49430.1
         (265 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC593954 similar to UniRef100_Q2HWB4 Cluster: Cyclin-li...    56   1e-07

>gnl|LJGI|DC593954 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (9%)
          Length = 574

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 56  tcgccagaatgcacctctgccgttcgcttatggacttcacccgccaccacct 107
           |||||| |||||||||| || ||||||  | |||||||||||||||||||||
Sbjct: 162 tcgccaaaatgcacctccgctgttcgccgacggacttcacccgccaccacct 213