Miyakogusa Predicted Gene

Lj4g3v1539310.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1539310.1 tr|G7L7I1|G7L7I1_MEDTR Disease resistance
RPP8-like protein OS=Medicago truncatula GN=MTR_8g020790 P,62.39,0,L
domain-like,NULL; P-loop containing nucleoside triphosphate
hydrolases,NULL; DISEASERSIST,Disease ,CUFF.49384.1
         (3485 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP082092                                                     119   1e-25

>gnl|LJGI|BP082092 
          Length = 388

 Score =  119 bits (60), Expect = 1e-25
 Identities = 60/60 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaattggattgagttgcttttttggattgcattagctgtggtgttgggtttttcggtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329 atgaattggattgagttgcttttttggattgcattagctgtggtgttgggtttttcggtg 388