Miyakogusa Predicted Gene

Lj4g3v1534990.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1534990.1 Non Chatacterized Hit- tr|I1JLP3|I1JLP3_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,57.2,0,CHROMO_2,Chromo domain/shadow; Ribonuclease
H-like,Ribonuclease H-like domain; Chromo domain-like,Ch,CUFF.49387.1
         (813 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC598260 weakly similar to UniRef100_Q84ZV5 Cluster: Po...    62   6e-09
gnl|LJGI|AV427422 similar to UniRef100_A2Q2C7 Cluster: RNA-direc...    56   4e-07

>gnl|LJGI|DC598260 weakly similar to UniRef100_Q84ZV5 Cluster: Polyprotein; n=1;
           Glycine max|Rep: Polyprotein - Glycine max (Soybean),
           partial (4%)
          Length = 560

 Score = 61.9 bits (31), Expect = 6e-09
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 714 tgagaattcgtgggaattagccactgccattatgtctcactttcctgattttccccttga 773
           ||||||||| ||||||||||| |||| |||  || ||   |||||| | |||||||||||
Sbjct: 290 tgagaattcttgggaattagctactgacatgttggctgcttttcctcaatttccccttga 349

                              
Query: 774 ggacaaggtggttctttta 792
           ||||||||| |||||||||
Sbjct: 350 ggacaaggtcgttctttta 368


>gnl|LJGI|AV427422 similar to UniRef100_A2Q2C7 Cluster: RNA-directed DNA polymerase
           (Reverse transcriptase); Chromo; Zinc finger, CCHC-type;
           Peptidase aspartic, active site; Polynucleotidyl
           transferase, Ribonuclease H fold; n=1; Medicago
           truncatula|Rep: RNA-directed DNA polymerase (Reverse
           transcriptase); Chromo; Zinc finger, CCHC-type;
           Peptidase aspartic, active site; Polynucleotidyl
           transferase, Ribonuclease H fold - Medicago truncatula
           (Barrel medic), partial (11%)
          Length = 417

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 26  ctgatggtcaaacagaggtgctgaatagatgtcttgaaacctatttgaggtg 77
           ||||||| ||||| |||||  | ||||| |||||||||||||||||||||||
Sbjct: 269 ctgatggacaaactgaggtagtaaataggtgtcttgaaacctatttgaggtg 320