Miyakogusa Predicted Gene
- Lj4g3v1512510.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v1512510.1 Non Chatacterized Hit- tr|I1JZZ9|I1JZZ9_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.54079 PE,88.7,0,Protein
kinase-like (PK-like),Protein kinase-like domain; no description,NULL;
Serine/Threonine prot,CUFF.49324.1
(1068 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP050035 similar to UniRef100_A7PD14 Cluster: Chromosom... 111 9e-24
>gnl|LJGI|BP050035 similar to UniRef100_A7PD14 Cluster: Chromosome chr17 scaffold_12,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_12, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (27%)
Length = 325
Score = 111 bits (56), Expect = 9e-24
Identities = 100/112 (89%), Gaps = 2/112 (1%)
Strand = Plus / Minus
Query: 868 ctcatcaacagatgttggtcaagcaatccaaataaaaggccacattttgatgagatagtt 927
||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 317 ctcattaatagatgctggtcaagcaatccagataaaaggccacattttgatgagatagtt 258
Query: 928 tcaattttggagaactata-cagaatcacttgagcaggat-ccagaattttt 977
|| |||||||||| || | ||||||||||| ||| |||| |||||||||||
Sbjct: 257 tcccttttggagaagtacaccagaatcacttaagccggatcccagaattttt 206