Miyakogusa Predicted Gene

Lj4g3v1452000.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1452000.1 Non Chatacterized Hit- tr|I1K034|I1K034_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.40497
PE,86.87,0,Raffinose_syn,Raffinose synthase; SUBFAMILY NOT NAMED,NULL;
FAMILY NOT NAMED,NULL; (Trans)glycosidas,CUFF.49278.1
         (1305 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV421962 similar to UniRef100_Q8VWN6 Cluster: Raffinose...   121   1e-26

>gnl|LJGI|AV421962 similar to UniRef100_Q8VWN6 Cluster: Raffinose synthase; n=1; Pisum
           sativum|Rep: Raffinose synthase - Pisum sativum (Garden
           pea), partial (20%)
          Length = 489

 Score =  121 bits (61), Expect = 1e-26
 Identities = 91/101 (90%)
 Strand = Plus / Plus

                                                                       
Query: 409 ccaaacggcacgtattggctgcaagggtgtcacatggtgcactgcgcctacaacagcttg 468
           ||||| ||||| | |||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 11  ccaaatggcacattttggctgcaagggtgtcacatggtgcactgtgcctacaacagtttg 70

                                                    
Query: 469 tggatgggaaactttgtccacccggattgggatatgttcca 509
           |||||||| |||||  ||||||| |||||||| ||||||||
Sbjct: 71  tggatggggaacttcatccacccagattgggacatgttcca 111